Human NINJ1/hNINJ1/NIN1 ORF/cDNA clone-Adenovirus plasmid (NM_004148.4)
Cat. No.: pGMAD001672
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days
Pre-made Human NINJ1/hNINJ1/NIN1 adenoviral expression plasmid for NINJ1 adenovirus packaging, NINJ1 adenovirus.
Our GM-Adenovirus vector is optimized with the GMVC-modified Adeasy adenovirus packaging system. Find more about the GMVC-modified adenovirus packaging system.
Go to
NINJ1/hNINJ1 products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product Description
Catalog ID | pGMAD001672 |
Gene Name | NINJ1 |
Accession Number | NM_004148.4 |
Gene ID | 4814 |
Species | Human |
Product Type | Adenovirus plasmid (overexpression) |
Insert Length | 459 bp |
Gene Alias | hNINJ1,NIN1,NINJURIN |
Fluorescent Reporter | EGFP |
Mammalian Cell Selection | Null |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | EF1 |
Resistance | Kanamycin |
ORF Nucleotide Sequence | ATGGACTCGGGAACCGAGGAGTACGAGCTCAACGGCGGCCTGCCTCCGGGCACACCCGGCTCCCCGGACGCCTCGCCGGCCCGCTGGGGCTGGAGGCACGGGCCCATCAACGTGAACCATTACGCCAGCAAGAAGAGCGCAGCCGAGAGCATGCTGGACATCGCGCTGCTGATGGCCAACGCGTCCCAGCTGAAGGCCGTCGTGGAACAGGGCCCCAGCTTCGCCTTCTATGTGCCCCTGGTGGTCCTCATCTCCATCTCCCTTGTGCTGCAGATCGGCGTGGGGGTGCTGCTCATCTTCCTTGTCAAGTACGACCTTAACAACCCGGCCAAGCACGCCAAGCTGGACTTCCTCAACAACCTGGCCACGGGCCTGGTGTTCATCATCGTGGTAGTCAACATCTTCATCACGGCCTTCGGGGTCCAGAAGCCCTTGATGGACATGGCACCCCAGCAGTAG |
ORF Protein Sequence | MDSGTEEYELNGGLPPGTPGSPDASPARWGWRHGPINVNHYASKKSAAESMLDIALLMANASQLKAVVEQGPSFAFYVPLVVLISISLVLQIGVGVLLIFLVKYDLNNPAKHAKLDFLNNLATGLVFIIVVVNIFITAFGVQKPLMDMAPQQ |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-SE0369-Ab | Anti-NINJ1/ NIN1/ NINJURIN functional antibody |
Target Antigen | GM-Tg-g-SE0369-Ag | NINJ1 protein |
ORF Viral Vector | pGMAD000163 | Human NINJ1 Adenovirus plasmid |
ORF Viral Vector | pGMAD001672 | Human NINJ1 Adenovirus plasmid |
ORF Viral Vector | vGMAD000163 | Human NINJ1 Adenovirus particle |
ORF Viral Vector | vGMAD001672 | Human NINJ1 Adenovirus particle |
Target information
Target ID | GM-SE0369 |
Target Name | NINJ1 |
Gene ID | 4814, 18081, 717218, 25338, 101092405, 610587, 511468, 100146796 |
Gene Symbol and Synonyms | NIN1,NINJ1,NINJURIN,ninjurin-1 |
Uniprot Accession | Q92982 |
Uniprot Entry Name | NINJ1_HUMAN |
Protein Sub-location | Secreted Protein/Potential Cytokines |
Category | Not Available |
Disease | Not Available |
Gene Ensembl | ENSG00000131669 |
Target Classification | Not Available |
The ninjurin protein is upregulated after nerve injury both in dorsal root ganglion neurons and in Schwann cells (Araki and Milbrandt, 1996 [PubMed 8780658]). It demonstrates properties of a homophilic adhesion molecule and promotes neurite outgrowth from primary cultured dorsal root ganglion neurons.[supplied by OMIM, Aug 2009]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.