Human NINJ1/hNINJ1/NIN1 ORF/cDNA clone-Adenovirus particle (NM_004148.4)

Cat. No.: vGMAD001672

Pre-made Human NINJ1/hNINJ1/NIN1 Adenovirus for NINJ1 overexpression in-vitro and in-vivo. The NINJ1 adenoviral vector excels as a vehicle for transient gene transfection in both stable cell lines and primary cells, including DC cells, macrophages, cardiomyocytes, hepatocytes, and neurons. The purified NINJ1-encoding adenovirus also stands out as a quintessential tool for in vivo studies and vaccine research initiatives.

At GM Vector Core (GMVC), we provide bespoke adenovirus development and manufacture various grades of adenoviruses utilizing cutting-edge techniques. Dive deeper into our offerings.

Target products collection

Go to NINJ1/hNINJ1 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Product information

Catalog No. Product Name Adenovirus Grade Adenovirus quantity
vGMAD001672 Human NINJ1 Adenovirus particle Research Grade-In vitro 1E+10PFU (1E+10pfu/ml×1ml)
5E+10PFU (1E+10pfu/ml×5ml)
1E+11PFU (1E+10pfu/ml×10ml)
Research Grade-In vivo 1E+11PFU (1E+11pfu/ml×1ml)
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMAD001672
Gene Name NINJ1
Accession Number NM_004148.4
Gene ID 4814
Species Human
Product Type Adenovirus particle (overexpression)
Insert Length 459 bp
Gene Alias hNINJ1,NIN1,NINJURIN
Fluorescent Reporter EGFP
Mammalian Cell Selection Null
Fusion Tag 3xflag (C-Terminal)
Promoter EF1
Resistance Kanamycin
ORF Nucleotide Sequence ATGGACTCGGGAACCGAGGAGTACGAGCTCAACGGCGGCCTGCCTCCGGGCACACCCGGCTCCCCGGACGCCTCGCCGGCCCGCTGGGGCTGGAGGCACGGGCCCATCAACGTGAACCATTACGCCAGCAAGAAGAGCGCAGCCGAGAGCATGCTGGACATCGCGCTGCTGATGGCCAACGCGTCCCAGCTGAAGGCCGTCGTGGAACAGGGCCCCAGCTTCGCCTTCTATGTGCCCCTGGTGGTCCTCATCTCCATCTCCCTTGTGCTGCAGATCGGCGTGGGGGTGCTGCTCATCTTCCTTGTCAAGTACGACCTTAACAACCCGGCCAAGCACGCCAAGCTGGACTTCCTCAACAACCTGGCCACGGGCCTGGTGTTCATCATCGTGGTAGTCAACATCTTCATCACGGCCTTCGGGGTCCAGAAGCCCTTGATGGACATGGCACCCCAGCAGTAG
ORF Protein Sequence MDSGTEEYELNGGLPPGTPGSPDASPARWGWRHGPINVNHYASKKSAAESMLDIALLMANASQLKAVVEQGPSFAFYVPLVVLISISLVLQIGVGVLLIFLVKYDLNNPAKHAKLDFLNNLATGLVFIIVVVNIFITAFGVQKPLMDMAPQQ

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE0369-Ab Anti-NINJ1/ NIN1/ NINJURIN functional antibody
    Target Antigen GM-Tg-g-SE0369-Ag NINJ1 protein
    ORF Viral Vector pGMAD000163 Human NINJ1 Adenovirus plasmid
    ORF Viral Vector pGMAD001672 Human NINJ1 Adenovirus plasmid
    ORF Viral Vector vGMAD000163 Human NINJ1 Adenovirus particle
    ORF Viral Vector vGMAD001672 Human NINJ1 Adenovirus particle


    Target information

    Target ID GM-SE0369
    Target Name NINJ1
    Gene ID 4814, 18081, 717218, 25338, 101092405, 610587, 511468, 100146796
    Gene Symbol and Synonyms NIN1,NINJ1,NINJURIN,ninjurin-1
    Uniprot Accession Q92982
    Uniprot Entry Name NINJ1_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000131669
    Target Classification Not Available

    The ninjurin protein is upregulated after nerve injury both in dorsal root ganglion neurons and in Schwann cells (Araki and Milbrandt, 1996 [PubMed 8780658]). It demonstrates properties of a homophilic adhesion molecule and promotes neurite outgrowth from primary cultured dorsal root ganglion neurons.[supplied by OMIM, Aug 2009]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.