Human BAX/Bax zeta ORF/cDNA clone-Lentivirus plasmid (BC014175)

Pre-made Human BAX/Bax zeta Lentiviral expression plasmid for BAX lentivirus packaging, BAX lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

Target products collectionGo to BAX/Bax zeta products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMLP-SPh-015 Human BAX Lentivirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMLP-SPh-015
Gene Name BAX
Accession Number BC014175
Gene ID 581
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 579 bp
Gene Alias Bax zeta
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGGACGGGTCCGGGGAGCAGCCCAGAGGCGGGGGGCCCACCAGCTCTGAGCAGATCATGAAGACAGGGGCCCTTTTGCTTCAGGGTTTCATCCAGGATCGAGCAGGGCGAATGGGGGGGGAGGCACCCGAGCTGGCCCTGGACCCGGTGCCTCAGGATGCGTCCACCAAGAAGCTGAGCGAGTGTCTCAAGCGCATCGGGGACGAACTGGACAGTAACATGGAGCTGCAGAGGATGATTGCCGCCGTGGACACAGACTCCCCCCGAGAGGTCTTTTTCCGAGTGGCAGCTGACATGTTTTCTGACGGCAACTTCAACTGGGGCCGGGTTGTCGCCCTTTTCTACTTTGCCAGCAAACTGGTGCTCAAGGCCCTGTGCACCAAGGTGCCGGAACTGATCAGAACCATCATGGGCTGGACATTGGACTTCCTCCGGGAGCGGCTGTTGGGCTGGATCCAAGACCAGGGTGGTTGGGACGGCCTCCTCTCCTACTTTGGGACGCCCACGTGGCAGACCGTGACCATCTTTGTGGCGGGAGTGCTCACCGCCTCACTCACCATCTGGAAGAAGATGGGCTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-IP0034-Ab Anti-BAX monoclonal antibody
    Target Antigen GM-Tg-g-IP0034-Ag BAX protein
    ORF Viral Vector pGMAD000113 Human BAX Adenovirus plasmid
    ORF Viral Vector pGMAP000055 Human BAX Adenovirus plasmid
    ORF Viral Vector pGMLP-SPh-015 Human BAX Lentivirus plasmid
    ORF Viral Vector pGMAP-SPh-155 Human BAX Adenovirus plasmid
    ORF Viral Vector vGMAD000113 Human BAX Adenovirus particle
    ORF Viral Vector vGMAP000055 Human BAX Adenovirus particle
    ORF Viral Vector vGMLP-SPh-015 Human BAX Lentivirus particle
    ORF Viral Vector vGMAP-SPh-155 Human BAX Adenovirus particle


    Target information

    Target ID GM-IP0034
    Target Name BAX
    Gene ID 581, 12028, 718948, 24887, 493837, 403523, 280730, 100054674
    Gene Symbol and Synonyms BAX,BCL2L4
    Uniprot Accession Q07812
    Uniprot Entry Name BAX_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Therapeutics Target
    Disease Cancer
    Gene Ensembl ENSG00000087088
    Target Classification Tumor-associated antigen (TAA)

    The protein encoded by this gene belongs to the BCL2 protein family. BCL2 family members form hetero- or homodimers and act as anti- or pro-apoptotic regulators that are involved in a wide variety of cellular activities. This protein forms a heterodimer with BCL2, and functions as an apoptotic activator. The association and the ratio of BAX to BCL2 also determines survival or death of a cell following an apoptotic stimulus. This protein is reported to interact with, and increase the opening of, the mitochondrial voltage-dependent anion channel (VDAC), which leads to the loss in membrane potential and the release of cytochrome c. The expression of this gene is regulated by the tumor suppressor P53 and has been shown to be involved in P53-mediated apoptosis. Multiple alternatively spliced transcript variants, which encode different isoforms, have been reported for this gene. [provided by RefSeq, Dec 2019]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.