Human BAX/Bax zeta ORF/cDNA clone-Adenovirus particle (BC014175)
Pre-made Human BAX/Bax zeta Adenovirus for BAX overexpression in-vitro and in-vivo. The BAX adenoviral vector excels as a vehicle for transient gene transfection in both stable cell lines and primary cells, including DC cells, macrophages, cardiomyocytes, hepatocytes, and neurons. The purified BAX-encoding adenovirus also stands out as a quintessential tool for in vivo studies and vaccine research initiatives.
At GM Vector Core (GMVC), we provide bespoke adenovirus development and manufacture various grades of adenoviruses utilizing cutting-edge techniques. Dive deeper into our offerings.
Go
to BAX/Bax zeta products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Adenovirus Grade | Adenovirus quantity |
vGMAP000055 | Human BAX Adenovirus particle | Research Grade-In vitro | 1E+10PFU (1E+10pfu/ml×1ml) |
5E+10PFU (1E+10pfu/ml×5ml) | |||
1E+11PFU (1E+10pfu/ml×10ml) | |||
Research Grade-In vivo | 1E+11PFU (1E+11pfu/ml×1ml) | ||
GMP-like Grade | inquiry | ||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMAP000055 |
Gene Name | BAX |
Accession Number | BC014175 |
Gene ID | 581 |
Species | Human |
Product Type | Adenovirus particle (overexpression) |
Insert Length | 579 bp |
Gene Alias | Bax zeta |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGGACGGGTCCGGGGAGCAGCCCAGAGGCGGGGGGCCCACCAGCTCTGAGCAGATCATGAAGACAGGGGCCCTTTTGCTTCAGGGTTTCATCCAGGATCGAGCAGGGCGAATGGGGGGGGAGGCACCCGAGCTGGCCCTGGACCCGGTGCCTCAGGATGCGTCCACCAAGAAGCTGAGCGAGTGTCTCAAGCGCATCGGGGACGAACTGGACAGTAACATGGAGCTGCAGAGGATGATTGCCGCCGTGGACACAGACTCCCCCCGAGAGGTCTTTTTCCGAGTGGCAGCTGACATGTTTTCTGACGGCAACTTCAACTGGGGCCGGGTTGTCGCCCTTTTCTACTTTGCCAGCAAACTGGTGCTCAAGGCCCTGTGCACCAAGGTGCCGGAACTGATCAGAACCATCATGGGCTGGACATTGGACTTCCTCCGGGAGCGGCTGTTGGGCTGGATCCAAGACCAGGGTGGTTGGGACGGCCTCCTCTCCTACTTTGGGACGCCCACGTGGCAGACCGTGACCATCTTTGTGGCGGGAGTGCTCACCGCCTCACTCACCATCTGGAAGAAGATGGGCTGA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-IP0034-Ab | Anti-BAX monoclonal antibody |
Target Antigen | GM-Tg-g-IP0034-Ag | BAX protein |
ORF Viral Vector | pGMAD000113 | Human BAX Adenovirus plasmid |
ORF Viral Vector | pGMAP000055 | Human BAX Adenovirus plasmid |
ORF Viral Vector | pGMLP-SPh-015 | Human BAX Lentivirus plasmid |
ORF Viral Vector | pGMAP-SPh-155 | Human BAX Adenovirus plasmid |
ORF Viral Vector | vGMAD000113 | Human BAX Adenovirus particle |
ORF Viral Vector | vGMAP000055 | Human BAX Adenovirus particle |
ORF Viral Vector | vGMLP-SPh-015 | Human BAX Lentivirus particle |
ORF Viral Vector | vGMAP-SPh-155 | Human BAX Adenovirus particle |
Target information
Target ID | GM-IP0034 |
Target Name | BAX |
Gene ID | 581, 12028, 718948, 24887, 493837, 403523, 280730, 100054674 |
Gene Symbol and Synonyms | BAX,BCL2L4 |
Uniprot Accession | Q07812 |
Uniprot Entry Name | BAX_HUMAN |
Protein Sub-location | Introcelluar Protein |
Category | Therapeutics Target |
Disease | Cancer |
Gene Ensembl | ENSG00000087088 |
Target Classification | Tumor-associated antigen (TAA) |
The protein encoded by this gene belongs to the BCL2 protein family. BCL2 family members form hetero- or homodimers and act as anti- or pro-apoptotic regulators that are involved in a wide variety of cellular activities. This protein forms a heterodimer with BCL2, and functions as an apoptotic activator. The association and the ratio of BAX to BCL2 also determines survival or death of a cell following an apoptotic stimulus. This protein is reported to interact with, and increase the opening of, the mitochondrial voltage-dependent anion channel (VDAC), which leads to the loss in membrane potential and the release of cytochrome c. The expression of this gene is regulated by the tumor suppressor P53 and has been shown to be involved in P53-mediated apoptosis. Multiple alternatively spliced transcript variants, which encode different isoforms, have been reported for this gene. [provided by RefSeq, Dec 2019]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.