Human SERPINA12/OL-64 ORF/cDNA clone-Lentivirus plasmid (NM_173850)

Pre-made Human SERPINA12/OL-64 Lentiviral expression plasmid for SERPINA12 lentivirus packaging, SERPINA12 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

Target products collectionGo to SERPINA12/OL-64 products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMLP000020 Human SERPINA12 Lentivirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMLP000020
Gene Name SERPINA12
Accession Number NM_173850
Gene ID 145264
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 1245 bp
Gene Alias OL-64
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGAACCCCACACTAGGCCTGGCCATTTTTCTGGCTGTTCTCCTCACGGTGAAAGGTCTTCTAAAGCCGAGCTTCTCACCAAGGAATTATAAAGCTTTGAGCGAGGTCCAAGGATGGAAGCAAAGGATGGCAGCCAAGGAGCTTGCAAGGCAGAACATGGACTTAGGCTTTAAGCTGCTCAAGAAGCTGGCCTTTTACAACCCTGGCAGGAACATCTTCCTATCCCCCTTGAGCATCTCTACAGCTTTCTCCATGCTGTGCCTGGGTGCCCAGGACAGCACCCTGGACGAGATCAAGCAGGGGTTCAACTTCAGAAAGATGCCAGAAAAAGATCTTCATGAGGGCTTCCATTACATCATCCACGAGCTGACCCAGAAGACCCAGGACCTCAAACTGAGCATTGGGAACACGCTGTTCATTGACCAGAGGCTGCAGCCACAGCGTAAGTTTTTGGAAGATGCCAAGAACTTTTACAGTGCCGAAACCATCCTTACCAACTTTCAGAATTTGGAAATGGCTCAGAAGCAGATCAATGACTTTATCAGTCAAAAAACCCATGGGAAAATTAACAACCTGATCGAGAATATAGACCCCGGCACTGTGATGCTTCTTGCAAATTATATTTTCTTTCGAGCCAGGTGGAAACATGAGTTTGATCCAAATGTAACTAAAGAGGAAGATTTCTTTCTGGAGAAAAACAGTTCAGTCAAGGTGCCCATGATGTTCCGTAGTGGCATATACCAAGTTGGCTATGACGATAAGCTCTCTTGCACCATCCTGGAAATACCCTACCAGAAAAATATCACAGCCATCTTCATCCTTCCTGATGAGGGCAAGCTGAAGCACTTGGAGAAGGGATTGCAGGTGGACACTTTCTCCAGATGGAAAACATTACTGTCACGCAGGGTCGTAGACGTGTCTGTACCCAGACTCCACATGACGGGCACCTTCGACCTGAAGAAGACTCTCTCCTACATAGGTGTCTCCAAAATCTTTGAGGAACATGGTGATCTCACCAAGATCGCCCCTCATCGCAGCCTGAAAGTGGGCGAGGCTGTGCACAAGGCTGAGCTGAAGATGGATGAGAGGGGTACGGAAGGGGCCGCTGGCACCGGAGCACAGACTCTGCCCATGGAGACACCACTCGTCGTCAAGATAGACAAACCCTATCTGCTGCTGATTTACAGCGAGAAAATACCTTCCGTGCTCTTCCTGGGAAAGATTGTTAACCCTATTGGAAAATAA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-MP2569-Ab Anti-SPA12/ SERPINA12/ OL-64 monoclonal antibody
    Target Antigen GM-Tg-g-MP2569-Ag SERPINA12 VLP (virus-like particle)
    Cytokine cks-Tg-g-GM-MP2569 serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 12 (SERPINA12) protein & antibody
    ORF Viral Vector pGMLP000020 Human SERPINA12 Lentivirus plasmid
    ORF Viral Vector vGMLP000020 Human SERPINA12 Lentivirus particle


    Target information

    Target ID GM-MP2569
    Target Name SERPINA12
    Gene ID 145264, 701708, 101088938, 612386, 100065308
    Gene Symbol and Synonyms OL-64,SERPINA12
    Uniprot Accession Q8IW75
    Uniprot Entry Name SPA12_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Cytokine Target
    Disease Not Available
    Gene Ensembl ENSG00000165953
    Target Classification Not Available

    Predicted to enable serine-type endopeptidase inhibitor activity. Predicted to be involved in negative regulation of endopeptidase activity. Predicted to act upstream of or within negative regulation of gluconeogenesis; positive regulation of signal transduction; and regulation of lipid metabolic process. Predicted to be located in plasma membrane. Predicted to be active in extracellular space. [provided by Alliance of Genome Resources, Apr 2022]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.