Human CXCL1/FSP/ GRO1 ORF/cDNA clone-Lentivirus plasmid (NM_001511)

Pre-made Human CXCL1/FSP/ GRO1 Lentiviral expression plasmid for CXCL1 lentivirus packaging, CXCL1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

Target products collectionGo to CXCL1/FSP products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMLP000056 Human CXCL1 Lentivirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMLP000056
Gene Name CXCL1
Accession Number NM_001511
Gene ID 2919
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 324 bp
Gene Alias FSP, GRO1, GROa, MGSA, MGSA-a, NAP-3, SCYB1
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGGCCCGCGCTGCTCTCTCCGCCGCCCCCAGCAATCCCCGGCTCCTGCGAGTGGCACTGCTGCTCCTGCTCCTGGTAGCCGCTGGCCGGCGCGCAGCAGGAGCGTCCGTGGCCACTGAACTGCGCTGCCAGTGCTTGCAGACCCTGCAGGGAATTCACCCCAAGAACATCCAAAGTGTGAACGTGAAGTCCCCCGGACCCCACTGCGCCCAAACCGAAGTCATAGCCACACTCAAGAATGGGCGGAAAGCTTGCCTCAATCCTGCATCCCCCATAGTTAAGAAAATCATCGAAAAGATGCTGAACAGTGACAAATCCAACTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T96005-Ab Anti-GROA/ CXCL1/ FSP functional antibody
    Target Antigen GM-Tg-g-T96005-Ag CXCL1 protein
    Cytokine cks-Tg-g-GM-T96005 chemokine (C-X-C motif) ligand 1 (CXCL1) protein & antibody
    ORF Viral Vector pGMLP000056 Human CXCL1 Lentivirus plasmid
    ORF Viral Vector vGMLP000056 Human CXCL1 Lentivirus particle


    Target information

    Target ID GM-T96005
    Target Name CXCL1
    Gene ID 2919, 574222
    Gene Symbol and Synonyms CXCL1,FSP,GRO1,GROa,MGSA,MGSA-a,NAP-3,SCYB1
    Uniprot Accession P09341
    Uniprot Entry Name GROA_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Therapeutics Target, Immuno-oncology Target, Cytokine Target
    Disease Prostate Cancer, Malignant neoplasm of bladder
    Gene Ensembl ENSG00000163739
    Target Classification Checkpoint-Immuno Oncology

    This antimicrobial gene encodes a member of the CXC subfamily of chemokines. The encoded protein is a secreted growth factor that signals through the G-protein coupled receptor, CXC receptor 2. This protein plays a role in inflammation and as a chemoattractant for neutrophils. Aberrant expression of this protein is associated with the growth and progression of certain tumors. A naturally occurring processed form of this protein has increased chemotactic activity. Alternate splicing results in coding and non-coding variants of this gene. A pseudogene of this gene is found on chromosome 4. [provided by RefSeq, Sep 2014]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.