Human CXCL1/FSP/ GRO1 ORF/cDNA clone-Lentivirus particle (NM_001511)
Pre-made Human CXCL1/FSP/ GRO1 Lentiviral expression plasmid for CXCL1 lentivirus packaging, CXCL1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go
to CXCL1/FSP products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
---|---|---|---|
vGMLP000056 | Human CXCL1 Lentivirus particle | Pilot Grade | 1.0E+8TU |
5.0E+8TU | |||
1.0E+9TU | |||
Research Grade | 1.0E+8TU | ||
5.0E+8TU | |||
1.0E+9TU | |||
GMP-like Grade | inquiry | ||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMLP000056 |
Gene Name | CXCL1 |
Accession Number | NM_001511 |
Gene ID | 2919 |
Species | Human |
Product Type | Lentivirus particle (overexpression) |
Insert Length | 324 bp |
Gene Alias | FSP, GRO1, GROa, MGSA, MGSA-a, NAP-3, SCYB1 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGGCCCGCGCTGCTCTCTCCGCCGCCCCCAGCAATCCCCGGCTCCTGCGAGTGGCACTGCTGCTCCTGCTCCTGGTAGCCGCTGGCCGGCGCGCAGCAGGAGCGTCCGTGGCCACTGAACTGCGCTGCCAGTGCTTGCAGACCCTGCAGGGAATTCACCCCAAGAACATCCAAAGTGTGAACGTGAAGTCCCCCGGACCCCACTGCGCCCAAACCGAAGTCATAGCCACACTCAAGAATGGGCGGAAAGCTTGCCTCAATCCTGCATCCCCCATAGTTAAGAAAATCATCGAAAAGATGCTGAACAGTGACAAATCCAACTGA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T96005-Ab | Anti-GROA/ CXCL1/ FSP functional antibody |
Target Antigen | GM-Tg-g-T96005-Ag | CXCL1 protein |
Cytokine | cks-Tg-g-GM-T96005 | chemokine (C-X-C motif) ligand 1 (CXCL1) protein & antibody |
ORF Viral Vector | pGMLP000056 | Human CXCL1 Lentivirus plasmid |
ORF Viral Vector | vGMLP000056 | Human CXCL1 Lentivirus particle |
Target information
Target ID | GM-T96005 |
Target Name | CXCL1 |
Gene ID | 2919, 574222 |
Gene Symbol and Synonyms | CXCL1,FSP,GRO1,GROa,MGSA,MGSA-a,NAP-3,SCYB1 |
Uniprot Accession | P09341 |
Uniprot Entry Name | GROA_HUMAN |
Protein Sub-location | Secreted Protein/Potential Cytokines |
Category | Therapeutics Target, Immuno-oncology Target, Cytokine Target |
Disease | Prostate Cancer, Malignant neoplasm of bladder |
Gene Ensembl | ENSG00000163739 |
Target Classification | Checkpoint-Immuno Oncology |
This antimicrobial gene encodes a member of the CXC subfamily of chemokines. The encoded protein is a secreted growth factor that signals through the G-protein coupled receptor, CXC receptor 2. This protein plays a role in inflammation and as a chemoattractant for neutrophils. Aberrant expression of this protein is associated with the growth and progression of certain tumors. A naturally occurring processed form of this protein has increased chemotactic activity. Alternate splicing results in coding and non-coding variants of this gene. A pseudogene of this gene is found on chromosome 4. [provided by RefSeq, Sep 2014]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.