Human UCP2/BMIQ4/ SLC25A8 ORF/cDNA clone-Lentivirus plasmid (NM_003355)

Pre-made Human UCP2/BMIQ4/ SLC25A8 Lentiviral expression plasmid for UCP2 lentivirus packaging, UCP2 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

Target products collectionGo to UCP2/BMIQ4 products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMLP000084 Human UCP2 Lentivirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMLP000084
Gene Name UCP2
Accession Number NM_003355
Gene ID 7351
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 930 bp
Gene Alias BMIQ4, SLC25A8, UCPH
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGGTTGGGTTCAAGGCCACAGATGTGCCCCCTACTGCCACTGTGAAGTTTCTTGGGGCTGGCACAGCTGCCTGCATCGCAGATCTCATCACCTTTCCTCTGGATACTGCTAAAGTCCGGTTACAGATCCAAGGAGAAAGTCAGGGGCCAGTGCGCGCTACAGCCAGCGCCCAGTACCGCGGTGTGATGGGCACCATTCTGACCATGGTGCGTACTGAGGGCCCCCGAAGCCTCTACAATGGGCTGGTTGCCGGCCTGCAGCGCCAAATGAGCTTTGCCTCTGTCCGCATCGGCCTGTATGATTCTGTCAAACAGTTCTACACCAAGGGCTCTGAGCATGCCAGCATTGGGAGCCGCCTCCTAGCAGGCAGCACCACAGGTGCCCTGGCTGTGGCTGTGGCCCAGCCCACGGATGTGGTAAAGGTCCGATTCCAAGCTCAGGCCCGGGCTGGAGGTGGTCGGAGATACCAAAGCACCGTCAATGCCTACAAGACCATTGCCCGAGAGGAAGGGTTCCGGGGCCTCTGGAAAGGGACCTCTCCCAATGTTGCTCGTAATGCCATTGTCAACTGTGCTGAGCTGGTGACCTATGACCTCATCAAGGATGCCCTCCTGAAAGCCAACCTCATGACAGATGACCTCCCTTGCCACTTCACTTCTGCCTTTGGGGCAGGCTTCTGCACCACTGTCATCGCCTCCCCTGTAGACGTGGTCAAGACGAGATACATGAACTCTGCCCTGGGCCAGTACAGTAGCGCTGGCCACTGTGCCCTTACCATGCTCCAGAAGGAGGGGCCCCGAGCCTTCTACAAAGGGTTCATGCCCTCCTTTCTCCGCTTGGGTTCCTGGAACGTGGTGATGTTCGTCACCTATGAGCAGCTGAAACGAGCCCTCATGGCTGCCTGCACTTCCCGAGAGGCTCCCTTCTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T84560-Ab Anti-UCP2 monoclonal antibody
    Target Antigen GM-Tg-g-T84560-Ag UCP2 protein
    ORF Viral Vector pGMAD000297 Rat Ucp2 Adenovirus plasmid
    ORF Viral Vector pGMAAV000146 Rat Ucp2 Adeno-associate virus(AAV) plasmid
    ORF Viral Vector pGMAAV000337 Rat Ucp2 Adeno-associate virus(AAV) plasmid
    ORF Viral Vector pGMLP000084 Human UCP2 Lentivirus plasmid
    ORF Viral Vector vGMAD000297 Rat Ucp2 Adenovirus particle
    ORF Viral Vector vGMAAV000146 Rat Ucp2 Adeno-associate virus(AAV) particle
    ORF Viral Vector vGMAAV000337 Rat Ucp2 Adeno-associate virus(AAV) particle
    ORF Viral Vector vGMLP000084 Human UCP2 Lentivirus particle


    Target information

    Target ID GM-T84560
    Target Name UCP2
    Gene ID 7351, 22228, 574198, 54315, 692194, 403576, 281562, 100052144
    Gene Symbol and Synonyms BMIQ4,SLC25A8,UCP 2,UCP2,UCPH
    Uniprot Accession P55851
    Uniprot Entry Name UCP2_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Therapeutics Target
    Disease Not Available
    Gene Ensembl ENSG00000175567
    Target Classification Not Available

    Mitochondrial uncoupling proteins (UCP) are members of the larger family of mitochondrial anion carrier proteins (MACP). UCPs separate oxidative phosphorylation from ATP synthesis with energy dissipated as heat, also referred to as the mitochondrial proton leak. UCPs facilitate the transfer of anions from the inner to the outer mitochondrial membrane and the return transfer of protons from the outer to the inner mitochondrial membrane. They also reduce the mitochondrial membrane potential in mammalian cells. Tissue specificity occurs for the different UCPs and the exact methods of how UCPs transfer H+/OH- are not known. UCPs contain the three homologous protein domains of MACPs. This gene is expressed in many tissues, with the greatest expression in skeletal muscle. It is thought to play a role in nonshivering thermogenesis, obesity and diabetes. Chromosomal order is 5'-UCP3-UCP2-3'. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.