Human UCP2/BMIQ4/SLC25A8 ORF/cDNA clone-Mammalian (Non-Viral Vector) plasmid (NM_003355)

Cat. No.: pGMPC004803
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human UCP2/BMIQ4/SLC25A8 Non-Viral expression plasmid (overexpression vector) for mouse UCP2 overexpression in unique cell transient transfection and stable cell line development.


Target products collection

Go to UCP2/BMIQ4 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMPC004803
Gene Name UCP2
Accession Number NM_003355
Gene ID 7351
Species Human
Product Type Mammalian (Non-Viral Vector) plasmid (overexpression)
Insert Length 930 bp
Gene Alias BMIQ4,SLC25A8,UCPH
Fluorescent Reporter Null
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGTTGGGTTCAAGGCCACAGATGTGCCCCCTACTGCCACTGTGAAGTTTCTTGGGGCTGGCACAGCTGCCTGCATCGCAGATCTCATCACCTTTCCTCTGGATACTGCTAAAGTCCGGTTACAGATCCAAGGAGAAAGTCAGGGGCCAGTGCGCGCTACAGCCAGCGCCCAGTACCGCGGTGTGATGGGCACCATTCTGACCATGGTGCGTACTGAGGGCCCCCGAAGCCTCTACAATGGGCTGGTTGCCGGCCTGCAGCGCCAAATGAGCTTTGCCTCTGTCCGCATCGGCCTGTATGATTCTGTCAAACAGTTCTACACCAAGGGCTCTGAGCATGCCAGCATTGGGAGCCGCCTCCTAGCAGGCAGCACCACAGGTGCCCTGGCTGTGGCTGTGGCCCAGCCCACGGATGTGGTAAAGGTCCGATTCCAAGCTCAGGCCCGGGCTGGAGGTGGTCGGAGATACCAAAGCACCGTCAATGCCTACAAGACCATTGCCCGAGAGGAAGGGTTCCGGGGCCTCTGGAAAGGGACCTCTCCCAATGTTGCTCGTAATGCCATTGTCAACTGTGCTGAGCTGGTGACCTATGACCTCATCAAGGATGCCCTCCTGAAAGCCAACCTCATGACAGATGACCTCCCTTGCCACTTCACTTCTGCCTTTGGGGCAGGCTTCTGCACCACTGTCATCGCCTCCCCTGTAGACGTGGTCAAGACGAGATACATGAACTCTGCCCTGGGCCAGTACAGTAGCGCTGGCCACTGTGCCCTTACCATGCTCCAGAAGGAGGGGCCCCGAGCCTTCTACAAAGGGTTCATGCCCTCCTTTCTCCGCTTGGGTTCCTGGAACGTGGTGATGTTCGTCACCTATGAGCAGCTGAAACGAGCCCTCATGGCTGCCTGCACTTCCCGAGAGGCTCCCTTCTGA
ORF Protein Sequence MVGFKATDVPPTATVKFLGAGTAACIADLITFPLDTAKVRLQIQGESQGPVRATASAQYRGVMGTILTMVRTEGPRSLYNGLVAGLQRQMSFASVRIGLYDSVKQFYTKGSEHASIGSRLLAGSTTGALAVAVAQPTDVVKVRFQAQARAGGGRRYQSTVNAYKTIAREEGFRGLWKGTSPNVARNAIVNCAELVTYDLIKDALLKANLMTDDLPCHFTSAFGAGFCTTVIASPVDVVKTRYMNSALGQYSSAGHCALTMLQKEGPRAFYKGFMPSFLRLGSWNVVMFVTYEQLKRALMAACTSREAPF

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T84560-Ab Anti-UCP2 monoclonal antibody
    Target Antigen GM-Tg-g-T84560-Ag UCP2 protein
    ORF Viral Vector pGMLP000084 Human UCP2 Lentivirus plasmid
    ORF Viral Vector pGMPC004803 Human UCP2 Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector vGMLP000084 Human UCP2 Lentivirus particle


    Target information

    Target ID GM-T84560
    Target Name UCP2
    Gene ID 7351, 22228, 574198, 54315, 692194, 403576, 281562, 100052144
    Gene Symbol and Synonyms BMIQ4,SLC25A8,UCP 2,UCP2,UCPH
    Uniprot Accession P55851
    Uniprot Entry Name UCP2_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Therapeutics Target
    Disease Not Available
    Gene Ensembl ENSG00000175567
    Target Classification Not Available

    Mitochondrial uncoupling proteins (UCP) are members of the larger family of mitochondrial anion carrier proteins (MACP). UCPs separate oxidative phosphorylation from ATP synthesis with energy dissipated as heat, also referred to as the mitochondrial proton leak. UCPs facilitate the transfer of anions from the inner to the outer mitochondrial membrane and the return transfer of protons from the outer to the inner mitochondrial membrane. They also reduce the mitochondrial membrane potential in mammalian cells. Tissue specificity occurs for the different UCPs and the exact methods of how UCPs transfer H+/OH- are not known. UCPs contain the three homologous protein domains of MACPs. This gene is expressed in many tissues, with the greatest expression in skeletal muscle. It is thought to play a role in nonshivering thermogenesis, obesity and diabetes. Chromosomal order is 5'-UCP3-UCP2-3'. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.