Human STOML2/HSPC108/SLP-2 ORF/cDNA clone-Lentivirus plasmid (NM_013442)
Cat. No.: pGMLP000134
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days
Pre-made Human STOML2/HSPC108/SLP-2 Lentiviral expression plasmid for STOML2 lentivirus packaging, STOML2 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go to
STOML2/HSPC108 products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product Description
Catalog ID | pGMLP000134 |
Gene Name | STOML2 |
Accession Number | NM_013442 |
Gene ID | 30968 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 1071 bp |
Gene Alias | HSPC108,SLP-2 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
ORF Nucleotide Sequence | ATGCTGGCGCGCGCGGCGCGGGGCACTGGGGCCCTTTTGCTGAGGGGCTCTCTACTGGCTTCTGGCCGCGCTCCGCGCCGCGCCTCCTCTGGATTGCCCCGAAACACCGTGGTACTGTTCGTGCCGCAGCAGGAGGCCTGGGTGGTGGAGCGAATGGGCCGATTCCACCGGATCCTGGAGCCTGGTTTGAACATCCTCATCCCTGTGTTAGACCGGATCCGATATGTGCAGAGTCTCAAGGAAATTGTCATCAACGTGCCTGAGCAGTCGGCTGTGACTCTCGACAATGTAACTCTGCAAATCGATGGAGTCCTTTACCTGCGCATCATGGACCCTTACAAGGCAAGCTACGGTGTGGAGGACCCTGAGTATGCCGTCACCCAGCTAGCTCAAACAACCATGAGATCAGAGCTCGGCAAACTCTCTCTGGACAAAGTCTTCCGGGAACGGGAGTCCCTGAATGCCAGCATTGTGGATGCCATCAACCAAGCTGCTGACTGCTGGGGTATCCGCTGCCTCCGTTATGAGATCAAGGATATCCATGTGCCACCCCGGGTGAAAGAGTCTATGCAGATGCAGGTGGAGGCAGAGCGGCGGAAACGGGCCACAGTTCTAGAGTCTGAGGGGACCCGAGAGTCGGCCATCAATGTGGCAGAAGGGAAGAAACAGGCCCAGATCCTGGCCTCCGAAGCAGAAAAGGCTGAACAGATAAATCAGGCAGCAGGAGAGGCCAGTGCAGTTCTGGCGAAGGCCAAGGCTAAAGCTGAAGCTATTCGAATCCTGGCTGCAGCTCTGACACAACATAATGGAGATGCAGCAGCTTCACTGACTGTGGCCGAGCAGTATGTCAGCGCGTTCTCCAAACTGGCCAAGGACTCCAACACTATCCTACTGCCCTCCAACCCTGGCGATGTCACCAGCATGGTGGCTCAGGCCATGGGTGTATATGGAGCCCTCACCAAAGCCCCAGTGCCAGGGACTCCAGACTCACTCTCCAGTGGGAGCAGCAGAGATGTCCAGGGTACAGATGCAAGTCTTGATGAGGAACTTGATCGAGTCAAGATGAGTTAG |
ORF Protein Sequence | MLARAARGTGALLLRGSLLASGRAPRRASSGLPRNTVVLFVPQQEAWVVERMGRFHRILEPGLNILIPVLDRIRYVQSLKEIVINVPEQSAVTLDNVTLQIDGVLYLRIMDPYKASYGVEDPEYAVTQLAQTTMRSELGKLSLDKVFRERESLNASIVDAINQAADCWGIRCLRYEIKDIHVPPRVKESMQMQVEAERRKRATVLESEGTRESAINVAEGKKQAQILASEAEKAEQINQAAGEASAVLAKAKAKAEAIRILAAALTQHNGDAAASLTVAEQYVSAFSKLAKDSNTILLPSNPGDVTSMVAQAMGVYGALTKAPVPGTPDSLSSGSSRDVQGTDASLDEELDRVKMS |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T75962-Ab | Anti-STML2/ STOML2/ HSPC108 monoclonal antibody |
Target Antigen | GM-Tg-g-T75962-Ag | STOML2 VLP (virus-like particle) |
ORF Viral Vector | pGMLP000134 | Human STOML2 Lentivirus plasmid |
ORF Viral Vector | vGMLP000134 | Human STOML2 Lentivirus particle |
Target information
Target ID | GM-T75962 |
Target Name | STOML2 |
Gene ID | 30968, 66592, 698458, 298203, 101088700, 474755, 510324, 100055756 |
Gene Symbol and Synonyms | 0610038F01Rik,HSPC108,MSLP2,SLP-2,STOML2 |
Uniprot Accession | Q9UJZ1 |
Uniprot Entry Name | STML2_HUMAN |
Protein Sub-location | Transmembrane Protein |
Category | Therapeutics Target |
Disease | Breast Cancer |
Gene Ensembl | ENSG00000165283 |
Target Classification | Not Available |
Enables GTPase binding activity and cardiolipin binding activity. Involved in several processes, including inorganic cation transmembrane transport; positive regulation of cardiolipin metabolic process; and positive regulation of mitochondrial DNA replication. Located in membrane raft; mitochondrial inner membrane; and mitochondrial intermembrane space. Is extrinsic component of plasma membrane. Colocalizes with several cellular components, including COP9 signalosome; T cell receptor complex; and immunological synapse. [provided by Alliance of Genome Resources, Apr 2022]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.