Human STOML2/HSPC108/SLP-2 ORF/cDNA clone-Lentivirus particle (NM_013442)

Cat. No.: vGMLP000134

Pre-made Human STOML2/HSPC108/SLP-2 Lentiviral expression plasmid for STOML2 lentivirus packaging, STOML2 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collection

Go to STOML2/HSPC108 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

pdf MSDS
pdf Datasheet

Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP000134 Human STOML2 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP000134
Gene Name STOML2
Accession Number NM_013442
Gene ID 30968
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 1071 bp
Gene Alias HSPC108,SLP-2
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGCTGGCGCGCGCGGCGCGGGGCACTGGGGCCCTTTTGCTGAGGGGCTCTCTACTGGCTTCTGGCCGCGCTCCGCGCCGCGCCTCCTCTGGATTGCCCCGAAACACCGTGGTACTGTTCGTGCCGCAGCAGGAGGCCTGGGTGGTGGAGCGAATGGGCCGATTCCACCGGATCCTGGAGCCTGGTTTGAACATCCTCATCCCTGTGTTAGACCGGATCCGATATGTGCAGAGTCTCAAGGAAATTGTCATCAACGTGCCTGAGCAGTCGGCTGTGACTCTCGACAATGTAACTCTGCAAATCGATGGAGTCCTTTACCTGCGCATCATGGACCCTTACAAGGCAAGCTACGGTGTGGAGGACCCTGAGTATGCCGTCACCCAGCTAGCTCAAACAACCATGAGATCAGAGCTCGGCAAACTCTCTCTGGACAAAGTCTTCCGGGAACGGGAGTCCCTGAATGCCAGCATTGTGGATGCCATCAACCAAGCTGCTGACTGCTGGGGTATCCGCTGCCTCCGTTATGAGATCAAGGATATCCATGTGCCACCCCGGGTGAAAGAGTCTATGCAGATGCAGGTGGAGGCAGAGCGGCGGAAACGGGCCACAGTTCTAGAGTCTGAGGGGACCCGAGAGTCGGCCATCAATGTGGCAGAAGGGAAGAAACAGGCCCAGATCCTGGCCTCCGAAGCAGAAAAGGCTGAACAGATAAATCAGGCAGCAGGAGAGGCCAGTGCAGTTCTGGCGAAGGCCAAGGCTAAAGCTGAAGCTATTCGAATCCTGGCTGCAGCTCTGACACAACATAATGGAGATGCAGCAGCTTCACTGACTGTGGCCGAGCAGTATGTCAGCGCGTTCTCCAAACTGGCCAAGGACTCCAACACTATCCTACTGCCCTCCAACCCTGGCGATGTCACCAGCATGGTGGCTCAGGCCATGGGTGTATATGGAGCCCTCACCAAAGCCCCAGTGCCAGGGACTCCAGACTCACTCTCCAGTGGGAGCAGCAGAGATGTCCAGGGTACAGATGCAAGTCTTGATGAGGAACTTGATCGAGTCAAGATGAGTTAG
ORF Protein Sequence MLARAARGTGALLLRGSLLASGRAPRRASSGLPRNTVVLFVPQQEAWVVERMGRFHRILEPGLNILIPVLDRIRYVQSLKEIVINVPEQSAVTLDNVTLQIDGVLYLRIMDPYKASYGVEDPEYAVTQLAQTTMRSELGKLSLDKVFRERESLNASIVDAINQAADCWGIRCLRYEIKDIHVPPRVKESMQMQVEAERRKRATVLESEGTRESAINVAEGKKQAQILASEAEKAEQINQAAGEASAVLAKAKAKAEAIRILAAALTQHNGDAAASLTVAEQYVSAFSKLAKDSNTILLPSNPGDVTSMVAQAMGVYGALTKAPVPGTPDSLSSGSSRDVQGTDASLDEELDRVKMS

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T75962-Ab Anti-STML2/ STOML2/ HSPC108 monoclonal antibody
    Target Antigen GM-Tg-g-T75962-Ag STOML2 VLP (virus-like particle)
    ORF Viral Vector pGMLP000134 Human STOML2 Lentivirus plasmid
    ORF Viral Vector vGMLP000134 Human STOML2 Lentivirus particle


    Target information

    Target ID GM-T75962
    Target Name STOML2
    Gene ID 30968, 66592, 698458, 298203, 101088700, 474755, 510324, 100055756
    Gene Symbol and Synonyms 0610038F01Rik,HSPC108,MSLP2,SLP-2,STOML2
    Uniprot Accession Q9UJZ1
    Uniprot Entry Name STML2_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target
    Disease Breast Cancer
    Gene Ensembl ENSG00000165283
    Target Classification Not Available

    Enables GTPase binding activity and cardiolipin binding activity. Involved in several processes, including inorganic cation transmembrane transport; positive regulation of cardiolipin metabolic process; and positive regulation of mitochondrial DNA replication. Located in membrane raft; mitochondrial inner membrane; and mitochondrial intermembrane space. Is extrinsic component of plasma membrane. Colocalizes with several cellular components, including COP9 signalosome; T cell receptor complex; and immunological synapse. [provided by Alliance of Genome Resources, Apr 2022]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.