Human SPRY1/hSPRY1 ORF/cDNA clone-Lentivirus plasmid (NM_005841)

Pre-made Human SPRY1/hSPRY1 Lentiviral expression plasmid for SPRY1 lentivirus packaging, SPRY1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

Target products collectionGo to SPRY-1/SPRY1/hSPRY1 products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMLP000158 Human SPRY1 Lentivirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMLP000158
Gene Name SPRY1
Accession Number NM_005841
Gene ID 10252
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 960 bp
Gene Alias hSPRY1
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGGATCCCCAAAATCAACATGGCAGTGGCAGTTCGTTAGTTGTGATCCAGCAGCCTTCTTTGGATAGCCGTCAGAGATTAGACTATGAGAGAGAGATTCAGCCTACTGCTATTTTGTCCTTAGACCAGATCAAGGCCATAAGAGGCAGCAATGAATACACAGAAGGGCCTTCGGTGGTGAAAAGACCTGCTCCTCGGACAGCACCAAGACAAGAAAAGCATGAAAGGACTCATGAAATCATACCAATTAATGTGAATAATAACTACGAGCACAGACACACAAGCCACCTGGGACATGCAGTACTCCCAAGTAATGCCAGGGGCCCCATTTTGAGCAGATCAACCAGCACTGGAAGTGCAGCCAGCTCTGGGAGCAACAGCAGTGCCTCTTCTGAACAGGGACTGTTAGGAAGGTCACCACCAACCAGACCAGTCCCTGGTCATAGGTCTGAAAGGGCAATCCGGACCCAGCCCAAGCAACTGATTGTGGATGACTTGAAGGGTTCCTTGAAAGAGGACCTGACACAGCACAAGTTCATTTGTGAACAGTGTGGGAAGTGCAAGTGTGGAGAATGCACTGCTCCCAGGACCCTACCATCCTGTTTGGCCTGTAACCGGCAGTGCCTTTGCTCTGCTGAGAGCATGGTGGAATATGGAACCTGCATGTGCTTAGTCAAGGGCATCTTCTACCACTGCTCCAATGACGACGAAGGGGATTCCTATTCAGATAATCCTTGCTCCTGTTCACAATCACACTGCTGCTCTAGATACCTGTGTATGGGAGCCATGTCTTTATTTTTACCTTGCTTACTCTGTTATCCTCCTGCTAAAGGATGCCTGAAGCTGTGCAGGAGGTGTTATGACTGGATCCATCGCCCAGGGTGCAGATGTAAGAACTCCAACACTGTCTATTGTAAGCTGGAGAGCTGCCCCTCCCGGGGTCAGGGTAAACCATCATGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T76540-Ab Anti-SPY1/ SPRY-1/ SPRY1 monoclonal antibody
    Target Antigen GM-Tg-g-T76540-Ag SPRY-1/SPRY1 VLP (virus-like particle)
    Cytokine cks-Tg-g-GM-T76540 sprouty homolog 1, antagonist of FGF signaling (Drosophila) (SPRY1) protein & antibody
    ORF Viral Vector pGMLP000158 Human SPRY1 Lentivirus plasmid
    ORF Viral Vector vGMLP000158 Human SPRY1 Lentivirus particle


    Target information

    Target ID GM-T76540
    Target Name SPRY-1
    Gene ID 10252, 24063, 708752, 294981, 101086473, 483838, 507095, 100063739
    Gene Symbol and Synonyms hSPRY1,sprouty1,spry-1,SPRY1
    Uniprot Accession O43609
    Uniprot Entry Name SPY1_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target, Cytokine Target
    Disease Not Available
    Gene Ensembl ENSG00000164056
    Target Classification Not Available

    Involved in negative regulation of fibroblast growth factor receptor signaling pathway. Located in Golgi apparatus; cytosol; and nucleoplasm. [provided by Alliance of Genome Resources, Apr 2022]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.