Human XCL1/ATAC/ LPTN ORF/cDNA clone-Lentivirus plasmid (NM_002995)

Pre-made Human XCL1/ATAC/ LPTN Lentiviral expression plasmid for XCL1 lentivirus packaging, XCL1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

Target products collectionGo to XCL1/ATAC products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMLP000163 Human XCL1 Lentivirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMLP000163
Gene Name XCL1
Accession Number NM_002995
Gene ID 6375
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 345 bp
Gene Alias ATAC, LPTN, LTN, SCM-1, SCM-1a, SCM1, SCM1A, SCYC1
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGAGACTTCTCATCCTGGCCCTCCTTGGCATCTGCTCTCTCACTGCATACATTGTGGAAGGTGTAGGGAGTGAAGTCTCAGATAAGAGGACCTGTGTGAGCCTCACTACCCAGCGACTGCCGGTTAGCAGAATCAAGACCTACACCATCACGGAAGGCTCCTTGAGAGCAGTAATTTTTATTACCAAACGTGGCCTAAAAGTCTGTGCTGATCCACAAGCCACATGGGTGAGAGACGTGGTCAGGAGCATGGACAGGAAATCCAACACCAGAAATAACATGATCCAGACCAAGCCAACAGGAACCCAGCAATCGACCAATACAGCTGTGACTCTGACTGGCTAG

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE1386-Ab Anti-XCL1/ ATAC/ LPTN functional antibody
    Target Antigen GM-Tg-g-SE1386-Ag XCL1 protein
    Cytokine cks-Tg-g-GM-SE1386 chemokine (C motif) ligand 1 (XCL1) protein & antibody
    ORF Viral Vector pGMLP000163 Human XCL1 Lentivirus plasmid
    ORF Viral Vector vGMLP000163 Human XCL1 Lentivirus particle


    Target information

    Target ID GM-SE1386
    Target Name XCL1
    Gene ID 6375, 100057696
    Gene Symbol and Synonyms ATAC,LPTN,LTN,SCM-1,SCM-1a,SCM1,SCM1A,SCYC1,XCL1
    Uniprot Accession P47992
    Uniprot Entry Name XCL1_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Cytokine Target
    Disease Not Available
    Gene Ensembl ENSG00000143184
    Target Classification Not Available

    This antimicrobial gene encodes a member of the chemokine superfamily. Chemokines function in inflammatory and immunological responses, inducing leukocyte migration and activation. The encoded protein is a member of the C-chemokine subfamily, retaining only two of four cysteines conserved in other chemokines, and is thought to be specifically chemotactic for T cells. This gene and a closely related family member are located on the long arm of chromosome 1. [provided by RefSeq, Sep 2014]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.