- • Up to 20%-50%* off first purchase
- • Bulk quantities available
- • Citation Reward application
Sample Application
- • Animal health test
- • In-vitro diagnostics
- • Food & Feed Safety
- • Environmental Safety
- • New drug discovery
Supports
- Talk to our Expert:
[email protected] -
Talk to our sales:
[email protected]
Protocol Library Download
 |
 |
Human IL17A/CTLA-8/ CTLA8 ORF/cDNA clone-Lentivirus plasmid (NM_002190)
Pre-made Human IL17A/CTLA-8/ CTLA8 Lentiviral expression plasmid for IL17A lentivirus packaging, IL17A lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go
to IL17/IL17A/CTLA-8 products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
| Catalog No. | Product Name | Plasmid Grade | Plasmid quantity |
|---|---|---|---|
| pGMLP000168 | Human IL17A Lentivirus plasmid | Research Grade | 10mg, 50mg, 100mg, 500mg, >1g |
| GMP-like Grade | 10mg, 50mg, 100mg, 500mg, >1g | ||
| High Quality (HQ) Grade | |||
| Seed | 5ug |
Product Description
| Catalog ID | pGMLP000168 |
| Gene Name | IL17A |
| Accession Number | NM_002190 |
| Gene ID | 3605 |
| Species | Human |
| Product Type | Lentivirus plasmid (overexpression) |
| Insert Length | 468 bp |
| Gene Alias | CTLA-8, CTLA8, IL-17, IL-17A, IL17 |
| Fluorescent Reporter | ZsGreen |
| Mammalian Cell Selection | Puromyocin |
| Fusion Tag | 3xflag (C-Terminal) |
| Promoter | CMV |
| Resistance | Amplicin |
| Sequence | ATGACTCCTGGGAAGACCTCATTGGTGTCACTGCTACTGCTGCTGAGCCTGGAGGCCATAGTGAAGGCAGGAATCACAATCCCACGAAATCCAGGATGCCCAAATTCTGAGGACAAGAACTTCCCCCGGACTGTGATGGTCAACCTGAACATCCATAACCGGAATACCAATACCAATCCCAAAAGGTCCTCAGATTACTACAACCGATCCACCTCACCTTGGAATCTCCACCGCAATGAGGACCCTGAGAGATATCCCTCTGTGATCTGGGAGGCAAAGTGCCGCCACTTGGGCTGCATCAACGCTGATGGGAACGTGGACTACCACATGAACTCTGTCCCCATCCAGCAAGAGATCCTGGTCCTGCGCAGGGAGCCTCCACACTGCCCCAACTCCTTCCGGCTGGAGAAGATACTGGTGTCCGTGGGCTGCACCTGTGTCACCCCGATTGTCCACCATGTGGCCTAA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Target information
| Target ID | GM-T22095 |
| Target Name | IL17 |
| Gene ID | 3605, 16171, 708123, 301289, 101095339, 481837, 282863, 100034142 |
| Gene Symbol and Synonyms | CTLA-8,CTLA8,IL-17,IL-17A,IL17,IL17A,ILA17 |
| Uniprot Accession | Q16552 |
| Uniprot Entry Name | IL17_HUMAN |
| Protein Sub-location | Secreted Protein/Potential Cytokines |
| Category | Therapeutics Target, Immuno-oncology Target, INN Index, Cytokine Target |
| Disease | Cancer |
| Gene Ensembl | ENSG00000112115 |
| Target Classification | Checkpoint-Immuno Oncology, Tumor-associated antigen (TAA) |
This gene is a member of the IL-17 receptor family which includes five members (IL-17RA-E) and the encoded protein is a proinflammatory cytokine produced by activated T cells. IL-17A-mediated downstream pathways induce the production of inflammatory molecules, chemokines, antimicrobial peptides, and remodeling proteins. The encoded protein elicits crucial impacts on host defense, cell trafficking, immune modulation, and tissue repair, with a key role in the induction of innate immune defenses. This cytokine stimulates non-hematopoietic cells and promotes chemokine production thereby attracting myeloid cells to inflammatory sites. This cytokine also regulates the activities of NF-kappaB and mitogen-activated protein kinases and can stimulate the expression of IL6 and cyclooxygenase-2 (PTGS2/COX-2), as well as enhance the production of nitric oxide (NO). IL-17A plays a pivotal role in various infectious diseases, inflammatory and autoimmune disorders, and cancer. High levels of this cytokine are associated with several chronic inflammatory diseases including rheumatoid arthritis, psoriasis and multiple sclerosis. The lung damage induced by the severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) is to a large extent, a result of the inflammatory response promoted by cytokines such as IL17A. [provided by RefSeq, Sep 2020]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.
Facebook
LinkedIn
Twitter
