Human FGF17/FGF-13/ FGF-17 ORF/cDNA clone-Lentivirus plasmid (NM_003867)
Pre-made Human FGF17/FGF-13/ FGF-17 Lentiviral expression plasmid for FGF17 lentivirus packaging, FGF17 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go
to FGF17/FGF-13 products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Plasmid Grade | Plasmid quantity |
---|---|---|---|
pGMLP000256 | Human FGF17 Lentivirus plasmid | Research Grade | 10mg, 50mg, 100mg, 500mg, >1g |
GMP-like Grade | 10mg, 50mg, 100mg, 500mg, >1g | ||
High Quality (HQ) Grade | |||
Seed | 5ug |
Product Description
Catalog ID | pGMLP000256 |
Gene Name | FGF17 |
Accession Number | NM_003867 |
Gene ID | 8822 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 651 bp |
Gene Alias | FGF-13, FGF-17, HH20 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGGGAGCCGCCCGCCTGCTGCCCAACCTCACTCTGTGCTTACAGCTGCTGATTCTCTGCTGTCAAACTCAGGGGGAGAATCACCCGTCTCCTAATTTTAACCAGTACGTGAGGGACCAGGGCGCCATGACCGACCAGCTGAGCAGGCGGCAGATCCGCGAGTACCAACTCTACAGCAGGACCAGTGGCAAGCACGTGCAGGTCACCGGGCGTCGCATCTCCGCCACCGCCGAGGACGGCAACAAGTTTGCCAAGCTCATAGTGGAGACGGACACGTTTGGCAGCCGGGTTCGCATCAAAGGGGCTGAGAGTGAGAAGTACATCTGTATGAACAAGAGGGGCAAGCTCATCGGGAAGCCCAGCGGGAAGAGCAAAGACTGCGTGTTCACGGAGATCGTGCTGGAGAACAACTATACGGCCTTCCAGAACGCCCGGCACGAGGGCTGGTTCATGGCCTTCACGCGGCAGGGGCGGCCCCGCCAGGCTTCCCGCAGCCGCCAGAACCAGCGCGAGGCCCACTTCATCAAGCGCCTCTACCAAGGCCAGCTGCCCTTCCCCAACCACGCCGAGAAGCAGAAGCAGTTCGAGTTTGTGGGCTCCGCCCCCACCCGCCGGACCAAGCGCACACGGCGGCCCCAGCCCCTCACGTAG |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-SE0918-Ab | Anti-FGF17/ FGF-13/ FGF-17 functional antibody |
Target Antigen | GM-Tg-g-SE0918-Ag | FGF17 protein |
Cytokine | cks-Tg-g-GM-SE0918 | fibroblast growth factor 17 (FGF17) protein & antibody |
ORF Viral Vector | pGMLP000256 | Human FGF17 Lentivirus plasmid |
ORF Viral Vector | vGMLP000256 | Human FGF17 Lentivirus particle |
Target information
Target ID | GM-SE0918 |
Target Name | FGF17 |
Gene ID | 8822, 14171, 706659, 29368, 101090606, 607952, 100300257, 100056444 |
Gene Symbol and Synonyms | FGF-13,FGF-17,FGF17,Fgf6b,HH20 |
Uniprot Accession | O60258 |
Uniprot Entry Name | FGF17_HUMAN |
Protein Sub-location | Secreted Protein/Potential Cytokines |
Category | Cytokine Target |
Disease | Lung Cancer |
Gene Ensembl | ENSG00000158815 |
Target Classification | Not Available |
This gene encodes a member of the fibroblast growth factor (FGF) family. Member of the FGF family possess broad mitogenic and cell survival activities, and are involved in a variety of biological processes including embryonic development cell growth, morphogenesis, tissue repair, tumor growth and invasion. This protein is expressed during embryogenesis and in the adult cerebellum and cortex and may be essential for vascular growth and normal brain development. Mutations in this gene are the cause of hypogonadotropic hypogonadism 20 with or without anosmia. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jan 2015]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.