Human FGF17/FGF-13/ FGF-17 ORF/cDNA clone-Lentivirus particle (NM_003867)

Pre-made Human FGF17/FGF-13/ FGF-17 Lentiviral expression plasmid for FGF17 lentivirus packaging, FGF17 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collectionGo to FGF17/FGF-13 products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP000256 Human FGF17 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP000256
Gene Name FGF17
Accession Number NM_003867
Gene ID 8822
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 651 bp
Gene Alias FGF-13, FGF-17, HH20
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGGGAGCCGCCCGCCTGCTGCCCAACCTCACTCTGTGCTTACAGCTGCTGATTCTCTGCTGTCAAACTCAGGGGGAGAATCACCCGTCTCCTAATTTTAACCAGTACGTGAGGGACCAGGGCGCCATGACCGACCAGCTGAGCAGGCGGCAGATCCGCGAGTACCAACTCTACAGCAGGACCAGTGGCAAGCACGTGCAGGTCACCGGGCGTCGCATCTCCGCCACCGCCGAGGACGGCAACAAGTTTGCCAAGCTCATAGTGGAGACGGACACGTTTGGCAGCCGGGTTCGCATCAAAGGGGCTGAGAGTGAGAAGTACATCTGTATGAACAAGAGGGGCAAGCTCATCGGGAAGCCCAGCGGGAAGAGCAAAGACTGCGTGTTCACGGAGATCGTGCTGGAGAACAACTATACGGCCTTCCAGAACGCCCGGCACGAGGGCTGGTTCATGGCCTTCACGCGGCAGGGGCGGCCCCGCCAGGCTTCCCGCAGCCGCCAGAACCAGCGCGAGGCCCACTTCATCAAGCGCCTCTACCAAGGCCAGCTGCCCTTCCCCAACCACGCCGAGAAGCAGAAGCAGTTCGAGTTTGTGGGCTCCGCCCCCACCCGCCGGACCAAGCGCACACGGCGGCCCCAGCCCCTCACGTAG

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE0918-Ab Anti-FGF17/ FGF-13/ FGF-17 functional antibody
    Target Antigen GM-Tg-g-SE0918-Ag FGF17 protein
    Cytokine cks-Tg-g-GM-SE0918 fibroblast growth factor 17 (FGF17) protein & antibody
    ORF Viral Vector pGMLP000256 Human FGF17 Lentivirus plasmid
    ORF Viral Vector vGMLP000256 Human FGF17 Lentivirus particle


    Target information

    Target ID GM-SE0918
    Target Name FGF17
    Gene ID 8822, 14171, 706659, 29368, 101090606, 607952, 100300257, 100056444
    Gene Symbol and Synonyms FGF-13,FGF-17,FGF17,Fgf6b,HH20
    Uniprot Accession O60258
    Uniprot Entry Name FGF17_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Cytokine Target
    Disease Lung Cancer
    Gene Ensembl ENSG00000158815
    Target Classification Not Available

    This gene encodes a member of the fibroblast growth factor (FGF) family. Member of the FGF family possess broad mitogenic and cell survival activities, and are involved in a variety of biological processes including embryonic development cell growth, morphogenesis, tissue repair, tumor growth and invasion. This protein is expressed during embryogenesis and in the adult cerebellum and cortex and may be essential for vascular growth and normal brain development. Mutations in this gene are the cause of hypogonadotropic hypogonadism 20 with or without anosmia. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jan 2015]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.