Human F8/AHF/ DXS1253E ORF/cDNA clone-Lentivirus plasmid (NM_019863)

Pre-made Human F8/AHF/ DXS1253E Lentiviral expression plasmid for F8 lentivirus packaging, F8 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

Target products collectionGo to F8/AHF products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMLP000410 Human F8 Lentivirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMLP000410
Gene Name F8
Accession Number NM_019863
Gene ID 2157
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 651 bp
Gene Alias AHF, DXS1253E, F8B, F8C, FVIII, HEMA
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGCGGATCCAAGACCCTGGGAAGGTCTTCTTTGGCAATGTGGATTCATCTGGGATAAAACACAATATTTTTAACCCTCCAATTATTGCTCGATACATCCGTTTGCACCCAACTCATTATAGCATTCGCAGCACTCTTCGCATGGAGTTGATGGGCTGTGATTTAAATAGTTGCAGCATGCCATTGGGAATGGAGAGTAAAGCAATATCAGATGCACAGATTACTGCTTCATCCTACTTTACCAATATGTTTGCCACCTGGTCTCCTTCAAAAGCTCGACTTCACCTCCAAGGGAGGAGTAATGCCTGGAGACCTCAGGTGAATAATCCAAAAGAGTGGCTGCAAGTGGACTTCCAGAAGACAATGAAAGTCACAGGAGTAACTACTCAGGGAGTAAAATCTCTGCTTACCAGCATGTATGTGAAGGAGTTCCTCATCTCCAGCAGTCAAGATGGCCATCAGTGGACTCTCTTTTTTCAGAATGGCAAAGTAAAGGTTTTTCAGGGAAATCAAGACTCCTTCACACCTGTGGTGAACTCTCTAGACCCACCGTTACTGACTCGCTACCTTCGAATTCACCCCCAGAGTTGGGTGCACCAGATTGCCCTGAGGATGGAGGTTCTGGGCTGCGAGGCACAGGACCTCTACTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Biosimilar GMP-Bios-INN-934 Pre-Made Omfiloctocog Alfa Biosimilar, Recombinant Protein targeting F8: Recombinant therapeutic protein targeting AHF/F8B/F8C/HEMA/FVIII/DXS1253E
    Biosimilar GMP-Bios-INN-809 Pre-Made Efanesoctocog Alfa Biosimilar, Fusion Protein targeting F8 fused with human IGHG1 Fc (Fragment constant): Recombinant therapeutic protein targeting AHF/F8B/F8C/HEMA/FVIII/DXS1253E
    Biosimilar GMP-Bios-INN-823 Pre-Made Efmoroctocog Alfa Biosimilar, Fusion Protein targeting F8 fused with human IGHG1 Fc (Fragment constant): Recombinant therapeutic protein targeting AHF/F8B/F8C/HEMA/FVIII/DXS1253E
    Target Antibody GM-Tg-g-T14602-Ab Anti-FA8/ F8/ AHF monoclonal antibody
    Target Antigen GM-Tg-g-T14602-Ag F8 VLP (virus-like particle)
    ORF Viral Vector pGMAD000412 Human F8 Adenovirus plasmid
    ORF Viral Vector pGMLP000410 Human F8 Lentivirus plasmid
    ORF Viral Vector pGMAP000016 Human F8 Adenovirus plasmid
    ORF Viral Vector vGMAD000412 Human F8 Adenovirus particle
    ORF Viral Vector vGMLP000410 Human F8 Lentivirus particle
    ORF Viral Vector vGMAP000016 Human F8 Adenovirus particle


    Target information

    Target ID GM-T14602
    Target Name F8
    Gene ID 2157, 14069, 100424151, 302470, 101092751, 403875, 100271720, 100063026
    Gene Symbol and Synonyms AHF,Cf-8,Cf8,DXS1253E,F8,F8B,F8C,FVIII,HEMA,THPH13
    Uniprot Accession P00451
    Uniprot Entry Name FA8_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target, INN Index
    Disease Not Available
    Gene Ensembl ENSG00000185010
    Target Classification Not Available

    This gene encodes coagulation factor VIII, which participates in the intrinsic pathway of blood coagulation; factor VIII is a cofactor for factor IXa which, in the presence of Ca+2 and phospholipids, converts factor X to the activated form Xa.  This gene produces two alternatively spliced transcripts. Transcript variant 1 encodes a large glycoprotein, isoform a, which circulates in plasma and associates with von Willebrand factor in a noncovalent complex. This protein undergoes multiple cleavage events. Transcript variant 2 encodes a putative small protein, isoform b, which consists primarily of the phospholipid binding domain of factor VIIIc. This binding domain is essential for coagulant activity. Defects in this gene results in hemophilia A, a common recessive X-linked coagulation disorder. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.