Human ZNF397/ZNF47/ZSCAN15 ORF/cDNA clone-Lentivirus plasmid (NM_032347)
Cat. No.: pGMLP000441
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days
Pre-made Human ZNF397/ZNF47/ZSCAN15 Lentiviral expression plasmid for ZNF397 lentivirus packaging, ZNF397 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go to
ZNF397/ZNF47 products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product Description
Catalog ID | pGMLP000441 |
Gene Name | ZNF397 |
Accession Number | NM_032347 |
Gene ID | 84307 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 828 bp |
Gene Alias | ZNF47,ZSCAN15 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
ORF Nucleotide Sequence | ATGGCTGTGGAATCTGGAGTGATTTCAACCCTGATACCTCAGGATCCTCCGGAACAAGAACTAATACTAGTGAAAGTAGAAGATAACTTTTCCTGGGATGAGAAATTTAAGCAGAATGGGAGTACTCAATCCTGCCAAGAATTGTTTCGTCAGCAATTCAGAAAATTTTGCTACCAGGAGACACCTGGGCCCCGGGAGGCTCTGAGCCGACTCCAGGAACTTTGCTATCAGTGGCTAATGCCAGAGTTGCACACAAAGGAGCAGATCTTAGAACTGCTGGTACTGGAGCAGTTCCTGAGCATTCTGCCTGAGGAGCTGCAGATCTGGGTTCAGCAACATAATCCAGAAAGCGGCGAGGAAGCTGTGACCCTGTTGGAGGATTTAGAGAGGGAGTTTGATGACCCAGGGCAGCAGGTCCCAGCTAGTCCACAGGGACCAGCAGTGCCATGGAAGGATTTAACATGTCTCAGAGCATCCCAAGAGTCAACAGACATCCACCTCCAGCCCTTAAAGACACAGCTGAAATCCTGGAAACCATGCCTTTCCCCTAAAAGTGATTGTGAGAACAGTGAAACAGCAACAAAAGAGGGCATCTCAGAAGAAAAATCACAGGGACTCCCTCAGGAACCTTCATTTCGAGGAATTAAGTTGTCCAGACCTCCCAAAGCTTCTTCAGCTATCCGTTGGGAATGTGTTTCTCCAGGAAGTTTTCCCGGCGATATCATAGCTGCTGAGGCTACACATTCAACAATTTCTTGCTTTGCCATCAACACTTTGCCAGCCACCATCCTGCCATCTAAAAATGTGAATAGAAAGTATTTTTCCTGA |
ORF Protein Sequence | MAVESGVISTLIPQDPPEQELILVKVEDNFSWDEKFKQNGSTQSCQELFRQQFRKFCYQETPGPREALSRLQELCYQWLMPELHTKEQILELLVLEQFLSILPEELQIWVQQHNPESGEEAVTLLEDLEREFDDPGQQVPASPQGPAVPWKDLTCLRASQESTDIHLQPLKTQLKSWKPCLSPKSDCENSETATKEGISEEKSQGLPQEPSFRGIKLSRPPKASSAIRWECVSPGSFPGDIIAAEATHSTISCFAINTLPATILPSKNVNRKYFS |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-MP2393-Ab | Anti-ZN397/ ZNF397/ ZNF47 monoclonal antibody |
Target Antigen | GM-Tg-g-MP2393-Ag | ZNF397 VLP (virus-like particle) |
ORF Viral Vector | pGMLP000441 | Human ZNF397 Lentivirus plasmid |
ORF Viral Vector | vGMLP000441 | Human ZNF397 Lentivirus particle |
Target information
Target ID | GM-MP2393 |
Target Name | ZNF397 |
Gene ID | 84307, 69256, 714878, 100909408, 101093968, 100686871, 506448 |
Gene Symbol and Synonyms | 2810411K16Rik,6720480F11Rik,Zfp397,ZNF397,ZNF47,ZSCAN15 |
Uniprot Accession | Q8NF99 |
Uniprot Entry Name | ZN397_HUMAN |
Protein Sub-location | Transmembrane Protein |
Category | Not Available |
Disease | Not Available |
Gene Ensembl | ENSG00000186812 |
Target Classification | Not Available |
This gene encodes a protein with a N-terminal SCAN domain, and the longer isoform contains nine C2H2-type zinc finger repeats in the C-terminal domain. The protein localizes to centromeres during interphase and early prophase, and different isoforms can repress or activate transcription in transfection studies. Multiple transcript variants encoding different isoforms have been found for this gene. Additional variants have been described, but their biological validity has not been determined. [provided by RefSeq, Oct 2009]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.