Human ZNF397/ZNF47/ZSCAN15 ORF/cDNA clone-Lentivirus particle (NM_032347)

Cat. No.: vGMLP000441

Pre-made Human ZNF397/ZNF47/ZSCAN15 Lentiviral expression plasmid for ZNF397 lentivirus packaging, ZNF397 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collection

Go to ZNF397/ZNF47 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

pdf MSDS
pdf Datasheet

Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP000441 Human ZNF397 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP000441
Gene Name ZNF397
Accession Number NM_032347
Gene ID 84307
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 828 bp
Gene Alias ZNF47,ZSCAN15
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGCTGTGGAATCTGGAGTGATTTCAACCCTGATACCTCAGGATCCTCCGGAACAAGAACTAATACTAGTGAAAGTAGAAGATAACTTTTCCTGGGATGAGAAATTTAAGCAGAATGGGAGTACTCAATCCTGCCAAGAATTGTTTCGTCAGCAATTCAGAAAATTTTGCTACCAGGAGACACCTGGGCCCCGGGAGGCTCTGAGCCGACTCCAGGAACTTTGCTATCAGTGGCTAATGCCAGAGTTGCACACAAAGGAGCAGATCTTAGAACTGCTGGTACTGGAGCAGTTCCTGAGCATTCTGCCTGAGGAGCTGCAGATCTGGGTTCAGCAACATAATCCAGAAAGCGGCGAGGAAGCTGTGACCCTGTTGGAGGATTTAGAGAGGGAGTTTGATGACCCAGGGCAGCAGGTCCCAGCTAGTCCACAGGGACCAGCAGTGCCATGGAAGGATTTAACATGTCTCAGAGCATCCCAAGAGTCAACAGACATCCACCTCCAGCCCTTAAAGACACAGCTGAAATCCTGGAAACCATGCCTTTCCCCTAAAAGTGATTGTGAGAACAGTGAAACAGCAACAAAAGAGGGCATCTCAGAAGAAAAATCACAGGGACTCCCTCAGGAACCTTCATTTCGAGGAATTAAGTTGTCCAGACCTCCCAAAGCTTCTTCAGCTATCCGTTGGGAATGTGTTTCTCCAGGAAGTTTTCCCGGCGATATCATAGCTGCTGAGGCTACACATTCAACAATTTCTTGCTTTGCCATCAACACTTTGCCAGCCACCATCCTGCCATCTAAAAATGTGAATAGAAAGTATTTTTCCTGA
ORF Protein Sequence MAVESGVISTLIPQDPPEQELILVKVEDNFSWDEKFKQNGSTQSCQELFRQQFRKFCYQETPGPREALSRLQELCYQWLMPELHTKEQILELLVLEQFLSILPEELQIWVQQHNPESGEEAVTLLEDLEREFDDPGQQVPASPQGPAVPWKDLTCLRASQESTDIHLQPLKTQLKSWKPCLSPKSDCENSETATKEGISEEKSQGLPQEPSFRGIKLSRPPKASSAIRWECVSPGSFPGDIIAAEATHSTISCFAINTLPATILPSKNVNRKYFS

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-MP2393-Ab Anti-ZN397/ ZNF397/ ZNF47 monoclonal antibody
    Target Antigen GM-Tg-g-MP2393-Ag ZNF397 VLP (virus-like particle)
    ORF Viral Vector pGMLP000441 Human ZNF397 Lentivirus plasmid
    ORF Viral Vector vGMLP000441 Human ZNF397 Lentivirus particle


    Target information

    Target ID GM-MP2393
    Target Name ZNF397
    Gene ID 84307, 69256, 714878, 100909408, 101093968, 100686871, 506448
    Gene Symbol and Synonyms 2810411K16Rik,6720480F11Rik,Zfp397,ZNF397,ZNF47,ZSCAN15
    Uniprot Accession Q8NF99
    Uniprot Entry Name ZN397_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000186812
    Target Classification Not Available

    This gene encodes a protein with a N-terminal SCAN domain, and the longer isoform contains nine C2H2-type zinc finger repeats in the C-terminal domain. The protein localizes to centromeres during interphase and early prophase, and different isoforms can repress or activate transcription in transfection studies. Multiple transcript variants encoding different isoforms have been found for this gene. Additional variants have been described, but their biological validity has not been determined. [provided by RefSeq, Oct 2009]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.