Human SLPI/ALK1/ ALP ORF/cDNA clone-Lentivirus plasmid (NM_003064)
Pre-made Human SLPI/ALK1/ ALP Lentiviral expression plasmid for SLPI lentivirus packaging, SLPI lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go
to SLPI/ALK1 products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Plasmid Grade | Plasmid quantity |
---|---|---|---|
pGMLP000454 | Human SLPI Lentivirus plasmid | Research Grade | 10mg, 50mg, 100mg, 500mg, >1g |
GMP-like Grade | 10mg, 50mg, 100mg, 500mg, >1g | ||
High Quality (HQ) Grade | |||
Seed | 5ug |
Product Description
Catalog ID | pGMLP000454 |
Gene Name | SLPI |
Accession Number | NM_003064 |
Gene ID | 6590 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 399 bp |
Gene Alias | ALK1, ALP, BLPI, HUSI, HUSI-I, MPI, WAP4, WFDC4 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGAAGTCCAGCGGCCTCTTCCCCTTCCTGGTGCTGCTTGCCCTGGGAACTCTGGCACCTTGGGCTGTGGAAGGCTCTGGAAAGTCCTTCAAAGCTGGAGTCTGTCCTCCTAAGAAATCTGCCCAGTGCCTTAGATACAAGAAACCTGAGTGCCAGAGTGACTGGCAGTGTCCAGGGAAGAAGAGATGTTGTCCTGACACTTGTGGCATCAAATGCCTGGATCCTGTTGACACCCCAAACCCAACAAGGAGGAAGCCTGGGAAGTGCCCAGTGACTTATGGCCAATGTTTGATGCTTAACCCCCCCAATTTCTGTGAGATGGATGGCCAGTGCAAGCGTGACTTGAAGTGTTGCATGGGCATGTGTGGGAAATCCTGCGTTTCCCCTGTGAAAGCTTGA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-SE1292-Ab | Anti-SLPI/ ALK1/ ALP functional antibody |
Target Antigen | GM-Tg-g-SE1292-Ag | SLPI protein |
ORF Viral Vector | pGMLP000454 | Human SLPI Lentivirus plasmid |
ORF Viral Vector | pGMAP000268 | Human SLPI Adenovirus plasmid |
ORF Viral Vector | vGMLP000454 | Human SLPI Lentivirus particle |
ORF Viral Vector | vGMAP000268 | Human SLPI Adenovirus particle |
Target information
Target ID | GM-SE1292 |
Target Name | SLPI |
Gene ID | 6590, 20568, 711156, 101090682 |
Gene Symbol and Synonyms | ALK1,ALP,BLPI,HUSI,HUSI-I,MPI,SLPI,WAP4,WFDC4 |
Uniprot Accession | P03973 |
Uniprot Entry Name | SLPI_HUMAN |
Protein Sub-location | Secreted Protein/Potential Cytokines |
Category | Not Available |
Disease | Prostate Cancer |
Gene Ensembl | ENSG00000124107 |
Target Classification | Not Available |
This gene encodes a secreted inhibitor which protects epithelial tissues from serine proteases. It is found in various secretions including seminal plasma, cervical mucus, and bronchial secretions, and has affinity for trypsin, leukocyte elastase, and cathepsin G. Its inhibitory effect contributes to the immune response by protecting epithelial surfaces from attack by endogenous proteolytic enzymes. This antimicrobial protein has antibacterial, antifungal and antiviral activity. [provided by RefSeq, Nov 2014]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.