Human SLPI/ALK1/ ALP ORF/cDNA clone-Lentivirus plasmid (NM_003064)

Pre-made Human SLPI/ALK1/ ALP Lentiviral expression plasmid for SLPI lentivirus packaging, SLPI lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

Target products collectionGo to SLPI/ALK1 products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMLP000454 Human SLPI Lentivirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMLP000454
Gene Name SLPI
Accession Number NM_003064
Gene ID 6590
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 399 bp
Gene Alias ALK1, ALP, BLPI, HUSI, HUSI-I, MPI, WAP4, WFDC4
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGAAGTCCAGCGGCCTCTTCCCCTTCCTGGTGCTGCTTGCCCTGGGAACTCTGGCACCTTGGGCTGTGGAAGGCTCTGGAAAGTCCTTCAAAGCTGGAGTCTGTCCTCCTAAGAAATCTGCCCAGTGCCTTAGATACAAGAAACCTGAGTGCCAGAGTGACTGGCAGTGTCCAGGGAAGAAGAGATGTTGTCCTGACACTTGTGGCATCAAATGCCTGGATCCTGTTGACACCCCAAACCCAACAAGGAGGAAGCCTGGGAAGTGCCCAGTGACTTATGGCCAATGTTTGATGCTTAACCCCCCCAATTTCTGTGAGATGGATGGCCAGTGCAAGCGTGACTTGAAGTGTTGCATGGGCATGTGTGGGAAATCCTGCGTTTCCCCTGTGAAAGCTTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE1292-Ab Anti-SLPI/ ALK1/ ALP functional antibody
    Target Antigen GM-Tg-g-SE1292-Ag SLPI protein
    ORF Viral Vector pGMLP000454 Human SLPI Lentivirus plasmid
    ORF Viral Vector pGMAP000268 Human SLPI Adenovirus plasmid
    ORF Viral Vector vGMLP000454 Human SLPI Lentivirus particle
    ORF Viral Vector vGMAP000268 Human SLPI Adenovirus particle


    Target information

    Target ID GM-SE1292
    Target Name SLPI
    Gene ID 6590, 20568, 711156, 101090682
    Gene Symbol and Synonyms ALK1,ALP,BLPI,HUSI,HUSI-I,MPI,SLPI,WAP4,WFDC4
    Uniprot Accession P03973
    Uniprot Entry Name SLPI_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Not Available
    Disease Prostate Cancer
    Gene Ensembl ENSG00000124107
    Target Classification Not Available

    This gene encodes a secreted inhibitor which protects epithelial tissues from serine proteases. It is found in various secretions including seminal plasma, cervical mucus, and bronchial secretions, and has affinity for trypsin, leukocyte elastase, and cathepsin G. Its inhibitory effect contributes to the immune response by protecting epithelial surfaces from attack by endogenous proteolytic enzymes. This antimicrobial protein has antibacterial, antifungal and antiviral activity. [provided by RefSeq, Nov 2014]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.