Human DHFR/DHFRP1/ DYR ORF/cDNA clone-Lentivirus plasmid (NM_000791)

Pre-made Human DHFR/DHFRP1/ DYR Lentiviral expression plasmid for DHFR lentivirus packaging, DHFR lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

Target products collectionGo to DHFR/DHFRP1 products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMLP000510 Human DHFR Lentivirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMLP000510
Gene Name DHFR
Accession Number NM_000791
Gene ID 1719
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 564 bp
Gene Alias DHFRP1, DYR
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGGTTGGTTCGCTAAACTGCATCGTCGCTGTGTCCCAGAACATGGGCATCGGCAAGAACGGGGACCTGCCCTGGCCACCGCTCAGGAATGAATTCAGATATTTCCAGAGAATGACCACAACCTCTTCAGTAGAAGGTAAACAGAATCTGGTGATTATGGGTAAGAAGACCTGGTTCTCCATTCCTGAGAAGAATCGACCTTTAAAGGGTAGAATTAATTTAGTTCTCAGCAGAGAACTCAAGGAACCTCCACAAGGAGCTCATTTTCTTTCCAGAAGTCTAGATGATGCCTTAAAACTTACTGAACAACCAGAATTAGCAAATAAAGTAGACATGGTCTGGATAGTTGGTGGCAGTTCTGTTTATAAGGAAGCCATGAATCACCCAGGCCATCTTAAACTATTTGTGACAAGGATCATGCAAGACTTTGAAAGTGACACGTTTTTTCCAGAAATTGATTTGGAGAAATATAAACTTCTGCCAGAATACCCAGGTGTTCTCTCTGATGTCCAGGAGGAGAAAGGCATTAAGTACAAATTTGAAGTATATGAGAAGAATGATTAA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T17345-Ab Anti-DHFR monoclonal antibody
    Target Antigen GM-Tg-g-T17345-Ag DHFR protein
    ORF Viral Vector pGMLP000510 Human DHFR Lentivirus plasmid
    ORF Viral Vector pGMAP000102 Human DHFR Adenovirus plasmid
    ORF Viral Vector vGMLP000510 Human DHFR Lentivirus particle
    ORF Viral Vector vGMAP000102 Human DHFR Adenovirus particle


    Target information

    Target ID GM-T17345
    Target Name DHFR
    Gene ID 1719, 13361, 711268, 24312, 101087964, 479165, 508809, 100073256
    Gene Symbol and Synonyms 8430436I03Rik,DHFR,DHFR1,DHFRP1,DYR
    Uniprot Accession P00374
    Uniprot Entry Name DYR_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Therapeutics Target
    Disease Cancer
    Gene Ensembl ENSG00000228716
    Target Classification Tumor-associated antigen (TAA)

    Dihydrofolate reductase converts dihydrofolate into tetrahydrofolate, a methyl group shuttle required for the de novo synthesis of purines, thymidylic acid, and certain amino acids. While the functional dihydrofolate reductase gene has been mapped to chromosome 5, multiple intronless processed pseudogenes or dihydrofolate reductase-like genes have been identified on separate chromosomes. Dihydrofolate reductase deficiency has been linked to megaloblastic anemia. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2014]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.