Human CSN1S1/CASA/ CSN1 ORF/cDNA clone-Lentivirus plasmid (NM_001890)
Pre-made Human CSN1S1/CASA/ CSN1 Lentiviral expression plasmid for CSN1S1 lentivirus packaging, CSN1S1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go
to CSN1S1/CASA products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Plasmid Grade | Plasmid quantity |
---|---|---|---|
pGMLP000549 | Human CSN1S1 Lentivirus plasmid | Research Grade | 10mg, 50mg, 100mg, 500mg, >1g |
GMP-like Grade | 10mg, 50mg, 100mg, 500mg, >1g | ||
High Quality (HQ) Grade | |||
Seed | 5ug |
Product Description
Catalog ID | pGMLP000549 |
Gene Name | CSN1S1 |
Accession Number | NM_001890 |
Gene ID | 1446 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 558 bp |
Gene Alias | CASA, CSN1 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGAGGCTTCTCATTCTCACCTGTCTTGTGGCTGTTGCTCTTGCCAGGCCTAAACTTCCTCTTAGATACCCAGAACGCCTTCAGAATCCATCAGAGAGCAGTGAGCCTATACCATTAGAATCAAGAGAGGAATACATGAATGGTATGAACAGGCAGAGAAACATTCTGAGAGAAAAACAGACTGATGAAATCAAGGATACTAGGAATGAGTCTACTCAGAACTGTGTTGTGGCAGAGCCTGAGAAGATGGAATCCAGCATCAGTTCATCGAGTGAGGAAATGTCTCTCAGTAAGTGTGCGGAACAGTTTTGTAGACTGAACGAATACAACCAACTTCAGCTGCAAGCTGCCCATGCCCAGGAGCAAATTCGCAGAATGAATGAAAACAGCCATGTCCAAGTGCCTTTCCAGCAGCTCAACCAACTTGCTGCCTACCCCTATGCTGTTTGGTACTATCCACAAATCATGCAGTATGTTCCTTTCCCACCGTTTTCCGACATCTCCAATCCCACTGCTCATGAAAATTATGAAAAAAATAACGTCATGCTACAGTGGTGA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-SE0829-Ab | Anti-CASA1/ CSN1S1/ CASA functional antibody |
Target Antigen | GM-Tg-g-SE0829-Ag | CSN1S1 protein |
ORF Viral Vector | pGMLP000549 | Human CSN1S1 Lentivirus plasmid |
ORF Viral Vector | pGMAP000479 | Human CSN1S1 Adenovirus plasmid |
ORF Viral Vector | vGMLP000549 | Human CSN1S1 Lentivirus particle |
ORF Viral Vector | vGMAP000479 | Human CSN1S1 Adenovirus particle |
Target information
Target ID | GM-SE0829 |
Target Name | CSN1S1 |
Gene ID | 1446, 12990, 24284, 102902663, 282208, 100033982 |
Gene Symbol and Synonyms | CASA,CSN1,CSN1S1,Csna,CSNS1 |
Uniprot Accession | P47710 |
Uniprot Entry Name | CASA1_HUMAN |
Protein Sub-location | Secreted Protein/Potential Cytokines |
Category | Not Available |
Disease | Not Available |
Gene Ensembl | ENSG00000126545 |
Target Classification | Not Available |
Predicted to be involved in response to dehydroepiandrosterone; response to estradiol; and response to steroid hormone. Located in extracellular space. [provided by Alliance of Genome Resources, Apr 2022]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.