Human CSN1S1/CASA/ CSN1 ORF/cDNA clone-Lentivirus particle (NM_001890)

Pre-made Human CSN1S1/CASA/ CSN1 Lentiviral expression plasmid for CSN1S1 lentivirus packaging, CSN1S1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collectionGo to CSN1S1/CASA products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP000549 Human CSN1S1 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP000549
Gene Name CSN1S1
Accession Number NM_001890
Gene ID 1446
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 558 bp
Gene Alias CASA, CSN1
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGAGGCTTCTCATTCTCACCTGTCTTGTGGCTGTTGCTCTTGCCAGGCCTAAACTTCCTCTTAGATACCCAGAACGCCTTCAGAATCCATCAGAGAGCAGTGAGCCTATACCATTAGAATCAAGAGAGGAATACATGAATGGTATGAACAGGCAGAGAAACATTCTGAGAGAAAAACAGACTGATGAAATCAAGGATACTAGGAATGAGTCTACTCAGAACTGTGTTGTGGCAGAGCCTGAGAAGATGGAATCCAGCATCAGTTCATCGAGTGAGGAAATGTCTCTCAGTAAGTGTGCGGAACAGTTTTGTAGACTGAACGAATACAACCAACTTCAGCTGCAAGCTGCCCATGCCCAGGAGCAAATTCGCAGAATGAATGAAAACAGCCATGTCCAAGTGCCTTTCCAGCAGCTCAACCAACTTGCTGCCTACCCCTATGCTGTTTGGTACTATCCACAAATCATGCAGTATGTTCCTTTCCCACCGTTTTCCGACATCTCCAATCCCACTGCTCATGAAAATTATGAAAAAAATAACGTCATGCTACAGTGGTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE0829-Ab Anti-CASA1/ CSN1S1/ CASA functional antibody
    Target Antigen GM-Tg-g-SE0829-Ag CSN1S1 protein
    ORF Viral Vector pGMLP000549 Human CSN1S1 Lentivirus plasmid
    ORF Viral Vector pGMAP000479 Human CSN1S1 Adenovirus plasmid
    ORF Viral Vector vGMLP000549 Human CSN1S1 Lentivirus particle
    ORF Viral Vector vGMAP000479 Human CSN1S1 Adenovirus particle


    Target information

    Target ID GM-SE0829
    Target Name CSN1S1
    Gene ID 1446, 12990, 24284, 102902663, 282208, 100033982
    Gene Symbol and Synonyms CASA,CSN1,CSN1S1,Csna,CSNS1
    Uniprot Accession P47710
    Uniprot Entry Name CASA1_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000126545
    Target Classification Not Available

    Predicted to be involved in response to dehydroepiandrosterone; response to estradiol; and response to steroid hormone. Located in extracellular space. [provided by Alliance of Genome Resources, Apr 2022]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.