Human CSN1S1 ORF/cDNA clone-Adenovirus particle (BC128227)

Pre-made Human CSN1S1/ Adenovirus for CSN1S1 overexpression in-vitro and in-vivo. The CSN1S1 adenoviral vector excels as a vehicle for transient gene transfection in both stable cell lines and primary cells, including DC cells, macrophages, cardiomyocytes, hepatocytes, and neurons. The purified CSN1S1-encoding adenovirus also stands out as a quintessential tool for in vivo studies and vaccine research initiatives.

At GM Vector Core (GMVC), we provide bespoke adenovirus development and manufacture various grades of adenoviruses utilizing cutting-edge techniques. Dive deeper into our offerings.

Target products collectionGo to CSN1S1/ products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Adenovirus Grade Adenovirus quantity
vGMAP000479 Human CSN1S1 Adenovirus particle Research Grade-In vitro 1E+10PFU (1E+10pfu/ml×1ml)
5E+10PFU (1E+10pfu/ml×5ml)
1E+11PFU (1E+10pfu/ml×10ml)
Research Grade-In vivo 1E+11PFU (1E+11pfu/ml×1ml)
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMAP000479
Gene Name CSN1S1
Accession Number BC128227
Gene ID 1446
Species Human
Product Type Adenovirus particle (overexpression)
Insert Length 558 bp
Gene Alias
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGAGGCTTCTCATTCTCACCTGTCTTGTGGCTGTTGCTCTTGCCAGGCCTAAACTTCCTCTTAGATACCCAGAACGCCTTCAGAATCCATCAGAGAGCAGTGAGCCTATACCATTAGAATCAAGAGAGGAATACATGAATGGTATGAACAGGCAGAGAAACATTCTGAGAGAAAAACAGACTGATGAAATCAAGGATACTAGGAATGAGTCTACTCAGAACTGTGTTGTGGCAGAGCCTGAGAAGATGGAATCCAGCATCAGTTCATCGAGTGAGGAAATGTCTCTCAGTAAGTGTGCGGAACAGTTTTGTAGACTGAACGAATACAACCAACTTCAGCTGCAAGCTGCCCATGCCCAGGAGCAAATTCGCAGAATGAATGAAAACAGCCATGTCCAAGTGCCTTTCCAGCAGCTCAACCAACTTGCTGCCTACCCCTATGCTGTTTGGTACTATCCACAAATCATGCAGTATGTTCCTTTCCCACCGTTTTCCGACATCTCCAATCCCACTGCTCATGAAAATTATGAAAAAAATAACGTCATGCTACAGTGGTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE0829-Ab Anti-CASA1/ CSN1S1/ CASA functional antibody
    Target Antigen GM-Tg-g-SE0829-Ag CSN1S1 protein
    ORF Viral Vector pGMLP000549 Human CSN1S1 Lentivirus plasmid
    ORF Viral Vector pGMAP000479 Human CSN1S1 Adenovirus plasmid
    ORF Viral Vector vGMLP000549 Human CSN1S1 Lentivirus particle
    ORF Viral Vector vGMAP000479 Human CSN1S1 Adenovirus particle


    Target information

    Target ID GM-SE0829
    Target Name CSN1S1
    Gene ID 1446, 12990, 24284, 102902663, 282208, 100033982
    Gene Symbol and Synonyms CASA,CSN1,CSN1S1,Csna,CSNS1
    Uniprot Accession P47710
    Uniprot Entry Name CASA1_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000126545
    Target Classification Not Available

    Predicted to be involved in response to dehydroepiandrosterone; response to estradiol; and response to steroid hormone. Located in extracellular space. [provided by Alliance of Genome Resources, Apr 2022]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.