Human CSN1S1 ORF/cDNA clone-Adenovirus particle (BC128227)
Pre-made Human CSN1S1/ Adenovirus for CSN1S1 overexpression in-vitro and in-vivo. The CSN1S1 adenoviral vector excels as a vehicle for transient gene transfection in both stable cell lines and primary cells, including DC cells, macrophages, cardiomyocytes, hepatocytes, and neurons. The purified CSN1S1-encoding adenovirus also stands out as a quintessential tool for in vivo studies and vaccine research initiatives.
At GM Vector Core (GMVC), we provide bespoke adenovirus development and manufacture various grades of adenoviruses utilizing cutting-edge techniques. Dive deeper into our offerings.
Go
to CSN1S1/ products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Adenovirus Grade | Adenovirus quantity |
vGMAP000479 | Human CSN1S1 Adenovirus particle | Research Grade-In vitro | 1E+10PFU (1E+10pfu/ml×1ml) |
5E+10PFU (1E+10pfu/ml×5ml) | |||
1E+11PFU (1E+10pfu/ml×10ml) | |||
Research Grade-In vivo | 1E+11PFU (1E+11pfu/ml×1ml) | ||
GMP-like Grade | inquiry | ||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMAP000479 |
Gene Name | CSN1S1 |
Accession Number | BC128227 |
Gene ID | 1446 |
Species | Human |
Product Type | Adenovirus particle (overexpression) |
Insert Length | 558 bp |
Gene Alias | |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGAGGCTTCTCATTCTCACCTGTCTTGTGGCTGTTGCTCTTGCCAGGCCTAAACTTCCTCTTAGATACCCAGAACGCCTTCAGAATCCATCAGAGAGCAGTGAGCCTATACCATTAGAATCAAGAGAGGAATACATGAATGGTATGAACAGGCAGAGAAACATTCTGAGAGAAAAACAGACTGATGAAATCAAGGATACTAGGAATGAGTCTACTCAGAACTGTGTTGTGGCAGAGCCTGAGAAGATGGAATCCAGCATCAGTTCATCGAGTGAGGAAATGTCTCTCAGTAAGTGTGCGGAACAGTTTTGTAGACTGAACGAATACAACCAACTTCAGCTGCAAGCTGCCCATGCCCAGGAGCAAATTCGCAGAATGAATGAAAACAGCCATGTCCAAGTGCCTTTCCAGCAGCTCAACCAACTTGCTGCCTACCCCTATGCTGTTTGGTACTATCCACAAATCATGCAGTATGTTCCTTTCCCACCGTTTTCCGACATCTCCAATCCCACTGCTCATGAAAATTATGAAAAAAATAACGTCATGCTACAGTGGTGA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-SE0829-Ab | Anti-CASA1/ CSN1S1/ CASA functional antibody |
Target Antigen | GM-Tg-g-SE0829-Ag | CSN1S1 protein |
ORF Viral Vector | pGMLP000549 | Human CSN1S1 Lentivirus plasmid |
ORF Viral Vector | pGMAP000479 | Human CSN1S1 Adenovirus plasmid |
ORF Viral Vector | vGMLP000549 | Human CSN1S1 Lentivirus particle |
ORF Viral Vector | vGMAP000479 | Human CSN1S1 Adenovirus particle |
Target information
Target ID | GM-SE0829 |
Target Name | CSN1S1 |
Gene ID | 1446, 12990, 24284, 102902663, 282208, 100033982 |
Gene Symbol and Synonyms | CASA,CSN1,CSN1S1,Csna,CSNS1 |
Uniprot Accession | P47710 |
Uniprot Entry Name | CASA1_HUMAN |
Protein Sub-location | Secreted Protein/Potential Cytokines |
Category | Not Available |
Disease | Not Available |
Gene Ensembl | ENSG00000126545 |
Target Classification | Not Available |
Predicted to be involved in response to dehydroepiandrosterone; response to estradiol; and response to steroid hormone. Located in extracellular space. [provided by Alliance of Genome Resources, Apr 2022]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.