Human AQP5/AQP-5/PPKB ORF/cDNA clone-Lentivirus plasmid (NM_001651)
Cat. No.: pGMLP000566
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days
Pre-made Human AQP5/AQP-5/PPKB Lentiviral expression plasmid for AQP5 lentivirus packaging, AQP5 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go to
AQP5/AQP-5 products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product Description
Catalog ID | pGMLP000566 |
Gene Name | AQP5 |
Accession Number | NM_001651 |
Gene ID | 362 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 798 bp |
Gene Alias | AQP-5,PPKB |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
ORF Nucleotide Sequence | ATGAAGAAGGAGGTGTGCTCCGTGGCCTTCCTCAAGGCCGTGTTCGCAGAGTTCTTGGCCACCCTCATCTTCGTCTTCTTTGGCCTGGGCTCGGCCCTCAAGTGGCCGTCGGCGCTGCCTACCATCCTGCAGATCGCGCTGGCGTTTGGCCTGGCCATAGGCACGCTGGCCCAGGCCCTGGGACCCGTGAGCGGCGGCCACATCAACCCCGCCATCACCCTGGCCCTCTTGGTGGGCAACCAGATCTCGCTGCTCCGGGCTTTCTTCTACGTGGCGGCCCAGCTGGTGGGCGCCATTGCCGGGGCTGGCATCCTCTACGGTGTGGCACCGCTCAATGCCCGGGGCAATCTGGCCGTCAACGCGCTCAACAACAACACAACGCAGGGCCAGGCCATGGTGGTGGAGCTGATTCTGACCTTCCAGCTGGCACTCTGCATCTTCGCCTCCACTGACTCCCGCCGCACCAGCCCTGTGGGCTCCCCAGCCCTGTCCATTGGCCTGTCTGTCACCCTGGGCCACCTTGTCGGAATCTACTTCACTGGCTGCTCCATGAACCCAGCCCGCTCTTTTGGCCCTGCGGTGGTCATGAATCGGTTCAGCCCCGCTCACTGGGTTTTCTGGGTAGGGCCCATCGTGGGGGCGGTCCTGGCTGCCATCCTTTACTTCTACCTGCTCTTCCCCAACTCCCTGAGCCTGAGTGAGCGTGTGGCCATCATCAAAGGCACGTATGAGCCTGACGAGGACTGGGAGGAGCAGCGGGAAGAGCGGAAGAAGACCATGGAGCTGACCACCCGCTGA |
ORF Protein Sequence | MKKEVCSVAFLKAVFAEFLATLIFVFFGLGSALKWPSALPTILQIALAFGLAIGTLAQALGPVSGGHINPAITLALLVGNQISLLRAFFYVAAQLVGAIAGAGILYGVAPLNARGNLAVNALNNNTTQGQAMVVELILTFQLALCIFASTDSRRTSPVGSPALSIGLSVTLGHLVGIYFTGCSMNPARSFGPAVVMNRFSPAHWVFWVGPIVGAVLAAILYFYLLFPNSLSLSERVAIIKGTYEPDEDWEEQREERKKTMELTTR |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-MP0081-Ab | Anti-AQP5/ AQP-5/ PPKB monoclonal antibody |
Target Antigen | GM-Tg-g-MP0081-Ag | AQP5 VLP (virus-like particle) |
ORF Viral Vector | pGMLP000566 | Human AQP5 Lentivirus plasmid |
ORF Viral Vector | pGMLP003170 | Human AQP5 Lentivirus plasmid |
ORF Viral Vector | pGMAP000339 | Human AQP5 Adenovirus plasmid |
ORF Viral Vector | vGMLP000566 | Human AQP5 Lentivirus particle |
ORF Viral Vector | vGMLP003170 | Human AQP5 Lentivirus particle |
ORF Viral Vector | vGMAP000339 | Human AQP5 Adenovirus particle |
Target information
Target ID | GM-MP0081 |
Target Name | AQP5 |
Gene ID | 362, 11830, 711804, 25241, 101093196, 486551, 782368, 111767458 |
Gene Symbol and Synonyms | AQP-5,AQP5,PPKB |
Uniprot Accession | P55064 |
Uniprot Entry Name | AQP5_HUMAN |
Protein Sub-location | Transmembrane Protein |
Category | Not Available |
Disease | Not Available |
Gene Ensembl | ENSG00000161798 |
Target Classification | Not Available |
Aquaporin 5 (AQP5) is a water channel protein. Aquaporins are a family of small integral membrane proteins related to the major intrinsic protein (MIP or AQP0). Aquaporin 5 plays a role in the generation of saliva, tears and pulmonary secretions. AQP0, AQP2, AQP5, and AQP6 are closely related and all map to 12q13. [provided by RefSeq, Jul 2008]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.