Human AQP5/AQP-5/PPKB ORF/cDNA clone-Lentivirus plasmid (NM_001651)

Cat. No.: pGMLP000566
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human AQP5/AQP-5/PPKB Lentiviral expression plasmid for AQP5 lentivirus packaging, AQP5 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.


Target products collection

Go to AQP5/AQP-5 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $499.5
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP000566
Gene Name AQP5
Accession Number NM_001651
Gene ID 362
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 798 bp
Gene Alias AQP-5,PPKB
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGAAGAAGGAGGTGTGCTCCGTGGCCTTCCTCAAGGCCGTGTTCGCAGAGTTCTTGGCCACCCTCATCTTCGTCTTCTTTGGCCTGGGCTCGGCCCTCAAGTGGCCGTCGGCGCTGCCTACCATCCTGCAGATCGCGCTGGCGTTTGGCCTGGCCATAGGCACGCTGGCCCAGGCCCTGGGACCCGTGAGCGGCGGCCACATCAACCCCGCCATCACCCTGGCCCTCTTGGTGGGCAACCAGATCTCGCTGCTCCGGGCTTTCTTCTACGTGGCGGCCCAGCTGGTGGGCGCCATTGCCGGGGCTGGCATCCTCTACGGTGTGGCACCGCTCAATGCCCGGGGCAATCTGGCCGTCAACGCGCTCAACAACAACACAACGCAGGGCCAGGCCATGGTGGTGGAGCTGATTCTGACCTTCCAGCTGGCACTCTGCATCTTCGCCTCCACTGACTCCCGCCGCACCAGCCCTGTGGGCTCCCCAGCCCTGTCCATTGGCCTGTCTGTCACCCTGGGCCACCTTGTCGGAATCTACTTCACTGGCTGCTCCATGAACCCAGCCCGCTCTTTTGGCCCTGCGGTGGTCATGAATCGGTTCAGCCCCGCTCACTGGGTTTTCTGGGTAGGGCCCATCGTGGGGGCGGTCCTGGCTGCCATCCTTTACTTCTACCTGCTCTTCCCCAACTCCCTGAGCCTGAGTGAGCGTGTGGCCATCATCAAAGGCACGTATGAGCCTGACGAGGACTGGGAGGAGCAGCGGGAAGAGCGGAAGAAGACCATGGAGCTGACCACCCGCTGA
ORF Protein Sequence MKKEVCSVAFLKAVFAEFLATLIFVFFGLGSALKWPSALPTILQIALAFGLAIGTLAQALGPVSGGHINPAITLALLVGNQISLLRAFFYVAAQLVGAIAGAGILYGVAPLNARGNLAVNALNNNTTQGQAMVVELILTFQLALCIFASTDSRRTSPVGSPALSIGLSVTLGHLVGIYFTGCSMNPARSFGPAVVMNRFSPAHWVFWVGPIVGAVLAAILYFYLLFPNSLSLSERVAIIKGTYEPDEDWEEQREERKKTMELTTR

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-MP0081-Ab Anti-AQP5/ AQP-5/ PPKB monoclonal antibody
    Target Antigen GM-Tg-g-MP0081-Ag AQP5 VLP (virus-like particle)
    ORF Viral Vector pGMLP000566 Human AQP5 Lentivirus plasmid
    ORF Viral Vector pGMLP003170 Human AQP5 Lentivirus plasmid
    ORF Viral Vector pGMAP000339 Human AQP5 Adenovirus plasmid
    ORF Viral Vector vGMLP000566 Human AQP5 Lentivirus particle
    ORF Viral Vector vGMLP003170 Human AQP5 Lentivirus particle
    ORF Viral Vector vGMAP000339 Human AQP5 Adenovirus particle


    Target information

    Target ID GM-MP0081
    Target Name AQP5
    Gene ID 362, 11830, 711804, 25241, 101093196, 486551, 782368, 111767458
    Gene Symbol and Synonyms AQP-5,AQP5,PPKB
    Uniprot Accession P55064
    Uniprot Entry Name AQP5_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000161798
    Target Classification Not Available

    Aquaporin 5 (AQP5) is a water channel protein.  Aquaporins are a family of small integral membrane proteins related to the major intrinsic protein (MIP or AQP0). Aquaporin 5 plays a role in the generation of saliva, tears and pulmonary secretions. AQP0, AQP2, AQP5, and AQP6 are closely related and all map to 12q13. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.