Human AQP5 ORF/cDNA clone-Adenovirus particle (BC032946)
Cat. No.: vGMAP000339
Pre-made Human AQP5/ Adenovirus for AQP5 overexpression in-vitro and in-vivo. The AQP5 adenoviral vector excels as a vehicle for transient gene transfection in both stable cell lines and primary cells, including DC cells, macrophages, cardiomyocytes, hepatocytes, and neurons. The purified AQP5-encoding adenovirus also stands out as a quintessential tool for in vivo studies and vaccine research initiatives.
At GM Vector Core (GMVC), we provide bespoke adenovirus development and manufacture various grades of adenoviruses utilizing cutting-edge techniques. Dive deeper into our offerings.
Go to
AQP5/ products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
| Catalog No. | Product Name | Adenovirus Grade | Adenovirus quantity |
| vGMAP000339 | Human AQP5 Adenovirus particle | Research Grade-In vitro | 1E+10PFU (1E+10pfu/ml×1ml) |
| 5E+10PFU (1E+10pfu/ml×5ml) | |||
| 1E+11PFU (1E+10pfu/ml×10ml) | |||
| Research Grade-In vivo | 1E+11PFU (1E+11pfu/ml×1ml) | ||
| GMP-like Grade | inquiry | ||
| GMP Grade | inquiry |
Product Description
| Catalog ID | vGMAP000339 |
| Gene Name | AQP5 |
| Accession Number | BC032946 |
| Gene ID | 362 |
| Species | Human |
| Product Type | Adenovirus particle (overexpression) |
| Insert Length | 798 bp |
| Gene Alias | |
| Fluorescent Reporter | GFP |
| Mammalian Cell Selection | Null |
| Fusion Tag | 3xflag (C-Terminal) |
| Promoter | EF1 |
| Resistance | Amplicin |
| ORF Nucleotide Sequence | ATGAAGAAGGAGGTGTGCTCCGTGGCCTTCCTCAAGGCCGTGTTCGCAGAGTTCTTGGCCACCCTCATCTTCGTCTTCTTTGGCCTGGGCTCGGCCCTCAAGTGGCCGTCGGCGCTGCCTACCATCCTGCAGATCGCGCTGGCGTTTGGCCTGGCCATAGGCACGCTGGCCCAGGCCCTGGGACCCGTGAGCGGCGGCCACATCAACCCCGCCATCACCCTGGCCCTCTTGGTGGGCAACCAGATCTCGCTGCTCCGGGCTTTCTTCTACGTGGCGGCCCAGCTGGTGGGCGCCATTGCCGGGGCTGGCATCCTCTACGGTGTGGCACCGCTCAATGCCCGGGGCAATCTGGCCGTCAACGCGCTCAACAACAACACAACGCAGGGCCAGGCCATGGTGGTGGAGCTGATTCTGACCTTCCAGCTGGCACTCTGCATCTTCGCCTCCACTGACTCCCGCCGCACCAGCCCTGTGGGCTCCCCAGCCCTGTCCATTGGCCTGTCTGTCACCCTGGGCCACCTTGTCGGAATCTACTTCACTGGCTGCTCCATGAACCCAGCCCGCTCTTTTGGCCCTGCGGTGGTCATGAATCGGTTCAGCCCCGCTCACTGGGTTTTCTGGGTAGGGCCCATCGTGGGGGCGGTCCTGGCTGCCATCCTTTACTTCTACCTGCTCTTCCCCAACTCCCTGAGCCTGAGTGAGCGTGTGGCCATCATCAAAGGCACGTATGAGCCTGACGAGGACTGGGAGGAGCAGCGGGAAGAGCGGAAGAAGACCATGGAGCTGACCACCCGCTGA |
| ORF Protein Sequence | MKKEVCSVAFLKAVFAEFLATLIFVFFGLGSALKWPSALPTILQIALAFGLAIGTLAQALGPVSGGHINPAITLALLVGNQISLLRAFFYVAAQLVGAIAGAGILYGVAPLNARGNLAVNALNNNTTQGQAMVVELILTFQLALCIFASTDSRRTSPVGSPALSIGLSVTLGHLVGIYFTGCSMNPARSFGPAVVMNRFSPAHWVFWVGPIVGAVLAAILYFYLLFPNSLSLSERVAIIKGTYEPDEDWEEQREERKKTMELTTR |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
| Category | Cat No. | Products Name |
|---|---|---|
| Target Antibody | GM-Tg-g-MP0081-Ab | Anti-AQP5/ AQP-5/ PPKB monoclonal antibody |
| Target Antigen | GM-Tg-g-MP0081-Ag | AQP5 VLP (virus-like particle) |
| ORF Viral Vector | pGMLP000566 | Human AQP5 Lentivirus plasmid |
| ORF Viral Vector | pGMLP003170 | Human AQP5 Lentivirus plasmid |
| ORF Viral Vector | pGMAP000339 | Human AQP5 Adenovirus plasmid |
| ORF Viral Vector | vGMLP000566 | Human AQP5 Lentivirus particle |
| ORF Viral Vector | vGMLP003170 | Human AQP5 Lentivirus particle |
| ORF Viral Vector | vGMAP000339 | Human AQP5 Adenovirus particle |
Target information
| Target ID | GM-MP0081 |
| Target Name | AQP5 |
| Gene ID | 362, 11830, 711804, 25241, 101093196, 486551, 782368, 111767458 |
| Gene Symbol and Synonyms | AQP-5,AQP5,PPKB |
| Uniprot Accession | P55064 |
| Uniprot Entry Name | AQP5_HUMAN |
| Protein Sub-location | Transmembrane Protein |
| Category | Not Available |
| Disease | Not Available |
| Gene Ensembl | ENSG00000161798 |
| Target Classification | Not Available |
Aquaporin 5 (AQP5) is a water channel protein. Aquaporins are a family of small integral membrane proteins related to the major intrinsic protein (MIP or AQP0). Aquaporin 5 plays a role in the generation of saliva, tears and pulmonary secretions. AQP0, AQP2, AQP5, and AQP6 are closely related and all map to 12q13. [provided by RefSeq, Jul 2008]
About GMVC

GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.


