Human RARB/HAP/ MCOPS12 ORF/cDNA clone-Lentivirus plasmid (NM_000965)
Pre-made Human RARB/HAP/ MCOPS12 Lentiviral expression plasmid for RARB lentivirus packaging, RARB lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go
to RARB/HAP products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Plasmid Grade | Plasmid quantity |
---|---|---|---|
pGMLP000710 | Human RARB Lentivirus plasmid | Research Grade | 10mg, 50mg, 100mg, 500mg, >1g |
GMP-like Grade | 10mg, 50mg, 100mg, 500mg, >1g | ||
High Quality (HQ) Grade | |||
Seed | 5ug |
Product Description
Catalog ID | pGMLP000710 |
Gene Name | RARB |
Accession Number | NM_000965 |
Gene ID | 5915 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 1347 bp |
Gene Alias | HAP, MCOPS12, NR1B2, RARbeta1, RRB2 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGTTTGACTGTATGGATGTTCTGTCAGTGAGTCCTGGGCAAATCCTGGATTTCTACACTGCGAGTCCGTCTTCCTGCATGCTCCAGGAGAAAGCTCTCAAAGCATGCTTCAGTGGATTGACCCAAACCGAATGGCAGCATCGGCACACTGCTCAATCAATTGAAACACAGAGCACCAGCTCTGAGGAACTCGTCCCAAGCCCCCCATCTCCACTTCCTCCCCCTCGAGTGTACAAACCCTGCTTCGTCTGCCAGGACAAATCATCAGGGTACCACTATGGGGTCAGCGCCTGTGAGGGATGTAAGGGCTTTTTCCGCAGAAGTATTCAGAAGAATATGATTTACACTTGTCACCGAGATAAGAACTGTGTTATTAATAAAGTCACCAGGAATCGATGCCAATACTGTCGACTCCAGAAGTGCTTTGAAGTGGGAATGTCCAAAGAATCTGTCAGGAATGACAGGAACAAGAAAAAGAAGGAGACTTCGAAGCAAGAATGCACAGAGAGCTATGAAATGACAGCTGAGTTGGACGATCTCACAGAGAAGATCCGAAAAGCTCACCAGGAAACTTTCCCTTCACTCTGCCAGCTGGGTAAATACACCACGAATTCCAGTGCTGACCATCGAGTCCGACTGGACCTGGGCCTCTGGGACAAATTCAGTGAACTGGCCACCAAGTGCATTATTAAGATCGTGGAGTTTGCTAAACGTCTGCCTGGTTTCACTGGCTTGACCATCGCAGACCAAATTACCCTGCTGAAGGCCGCCTGCCTGGACATCCTGATTCTTAGAATTTGCACCAGGTATACCCCAGAACAAGACACCATGACTTTCTCAGACGGCCTTACCCTAAATCGAACTCAGATGCACAATGCTGGATTTGGTCCTCTGACTGACCTTGTGTTCACCTTTGCCAACCAGCTCCTGCCTTTGGAAATGGATGACACAGAAACAGGCCTTCTCAGTGCCATCTGCTTAATCTGTGGAGACCGCCAGGACCTTGAGGAACCGACAAAAGTAGATAAGCTACAAGAACCATTGCTGGAAGCACTAAAAATTTATATCAGAAAAAGACGACCCAGCAAGCCTCACATGTTTCCAAAGATCTTAATGAAAATCACAGATCTCCGTAGCATCAGTGCTAAAGGTGCAGAGCGTGTAATTACCTTGAAAATGGAAATTCCTGGATCAATGCCACCTCTCATTCAAGAAATGCTGGAGAATTCTGAAGGACATGAACCCTTGACCCCAAGTTCAAGTGGGAACACAGCAGAGCACAGTCCTAGCATCTCACCCAGCTCAGTGGAAAACAGTGGGGTCAGTCAGTCACCACTCGTGCAATAA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T61657-Ab | Anti-RARB monoclonal antibody |
Target Antigen | GM-Tg-g-T61657-Ag | RARB protein |
ORF Viral Vector | pGMPC000122 | Human RARB Mammalian (Non-Viral Vector) plasmid |
ORF Viral Vector | pGMLP000710 | Human RARB Lentivirus plasmid |
ORF Viral Vector | vGMLP000710 | Human RARB Lentivirus particle |
Target information
Target ID | GM-T61657 |
Target Name | RARB |
Gene ID | 5915, 218772, 700485, 24706, 101085742, 477045, 616895, 100051546 |
Gene Symbol and Synonyms | A830025K23,HAP,MCOPS12,NR1B2,RARB,RARbeta,RARbeta1,RRB2 |
Uniprot Accession | P10826 |
Uniprot Entry Name | RARB_HUMAN |
Protein Sub-location | Introcelluar Protein |
Category | Therapeutics Target |
Disease | Lung Cancer |
Gene Ensembl | ENSG00000077092 |
Target Classification | Not Available |
This gene encodes retinoic acid receptor beta, a member of the thyroid-steroid hormone receptor superfamily of nuclear transcriptional regulators. This receptor localizes to the cytoplasm and to subnuclear compartments. It binds retinoic acid, the biologically active form of vitamin A which mediates cellular signalling in embryonic morphogenesis, cell growth and differentiation. It is thought that this protein limits growth of many cell types by regulating gene expression. The gene was first identified in a hepatocellular carcinoma where it flanks a hepatitis B virus integration site. Alternate promoter usage and differential splicing result in multiple transcript variants. [provided by RefSeq, Mar 2014]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.