- • Up to 20%-50%* off first purchase
- • Bulk quantities available
- • Citation Reward application
Sample Application
- • Animal health test
- • In-vitro diagnostics
- • Food & Feed Safety
- • Environmental Safety
- • New drug discovery
Supports
- Talk to our Expert:
[email protected] -
Talk to our sales:
[email protected]
Protocol Library Download
 |
 |
Human RARB/HAP/ MCOPS12 ORF/cDNA clone-Lentivirus particle (NM_000965)
Pre-made Human RARB/HAP/ MCOPS12 Lentiviral expression plasmid for RARB lentivirus packaging, RARB lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go
to RARB/HAP products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
| Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
|---|---|---|---|
| vGMLP000710 | Human RARB Lentivirus particle | Pilot Grade | 1.0E+8TU |
| 5.0E+8TU | |||
| 1.0E+9TU | |||
| Research Grade | 1.0E+8TU | ||
| 5.0E+8TU | |||
| 1.0E+9TU | |||
| GMP-like Grade | inquiry | ||
| GMP Grade | inquiry |
Product Description
| Catalog ID | vGMLP000710 |
| Gene Name | RARB |
| Accession Number | NM_000965 |
| Gene ID | 5915 |
| Species | Human |
| Product Type | Lentivirus particle (overexpression) |
| Insert Length | 1347 bp |
| Gene Alias | HAP, MCOPS12, NR1B2, RARbeta1, RRB2 |
| Fluorescent Reporter | ZsGreen |
| Mammalian Cell Selection | Puromyocin |
| Fusion Tag | 3xflag (C-Terminal) |
| Promoter | CMV |
| Resistance | Amplicin |
| Sequence | ATGTTTGACTGTATGGATGTTCTGTCAGTGAGTCCTGGGCAAATCCTGGATTTCTACACTGCGAGTCCGTCTTCCTGCATGCTCCAGGAGAAAGCTCTCAAAGCATGCTTCAGTGGATTGACCCAAACCGAATGGCAGCATCGGCACACTGCTCAATCAATTGAAACACAGAGCACCAGCTCTGAGGAACTCGTCCCAAGCCCCCCATCTCCACTTCCTCCCCCTCGAGTGTACAAACCCTGCTTCGTCTGCCAGGACAAATCATCAGGGTACCACTATGGGGTCAGCGCCTGTGAGGGATGTAAGGGCTTTTTCCGCAGAAGTATTCAGAAGAATATGATTTACACTTGTCACCGAGATAAGAACTGTGTTATTAATAAAGTCACCAGGAATCGATGCCAATACTGTCGACTCCAGAAGTGCTTTGAAGTGGGAATGTCCAAAGAATCTGTCAGGAATGACAGGAACAAGAAAAAGAAGGAGACTTCGAAGCAAGAATGCACAGAGAGCTATGAAATGACAGCTGAGTTGGACGATCTCACAGAGAAGATCCGAAAAGCTCACCAGGAAACTTTCCCTTCACTCTGCCAGCTGGGTAAATACACCACGAATTCCAGTGCTGACCATCGAGTCCGACTGGACCTGGGCCTCTGGGACAAATTCAGTGAACTGGCCACCAAGTGCATTATTAAGATCGTGGAGTTTGCTAAACGTCTGCCTGGTTTCACTGGCTTGACCATCGCAGACCAAATTACCCTGCTGAAGGCCGCCTGCCTGGACATCCTGATTCTTAGAATTTGCACCAGGTATACCCCAGAACAAGACACCATGACTTTCTCAGACGGCCTTACCCTAAATCGAACTCAGATGCACAATGCTGGATTTGGTCCTCTGACTGACCTTGTGTTCACCTTTGCCAACCAGCTCCTGCCTTTGGAAATGGATGACACAGAAACAGGCCTTCTCAGTGCCATCTGCTTAATCTGTGGAGACCGCCAGGACCTTGAGGAACCGACAAAAGTAGATAAGCTACAAGAACCATTGCTGGAAGCACTAAAAATTTATATCAGAAAAAGACGACCCAGCAAGCCTCACATGTTTCCAAAGATCTTAATGAAAATCACAGATCTCCGTAGCATCAGTGCTAAAGGTGCAGAGCGTGTAATTACCTTGAAAATGGAAATTCCTGGATCAATGCCACCTCTCATTCAAGAAATGCTGGAGAATTCTGAAGGACATGAACCCTTGACCCCAAGTTCAAGTGGGAACACAGCAGAGCACAGTCCTAGCATCTCACCCAGCTCAGTGGAAAACAGTGGGGTCAGTCAGTCACCACTCGTGCAATAA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
| Category | Cat No. | Products Name |
|---|---|---|
| Target Antibody | GM-Tg-g-T61657-Ab | Anti-RARB monoclonal antibody |
| Target Antigen | GM-Tg-g-T61657-Ag | RARB protein |
| ORF Viral Vector | pGMPC000122 | Human RARB Mammalian (Non-Viral Vector) plasmid |
| ORF Viral Vector | pGMLP000710 | Human RARB Lentivirus plasmid |
| ORF Viral Vector | vGMLP000710 | Human RARB Lentivirus particle |
Target information
| Target ID | GM-T61657 |
| Target Name | RARB |
| Gene ID | 5915, 218772, 700485, 24706, 101085742, 477045, 616895, 100051546 |
| Gene Symbol and Synonyms | A830025K23,HAP,MCOPS12,NR1B2,RARB,RARbeta,RARbeta1,RRB2 |
| Uniprot Accession | P10826 |
| Uniprot Entry Name | RARB_HUMAN |
| Protein Sub-location | Introcelluar Protein |
| Category | Therapeutics Target |
| Disease | Lung Cancer |
| Gene Ensembl | ENSG00000077092 |
| Target Classification | Not Available |
This gene encodes retinoic acid receptor beta, a member of the thyroid-steroid hormone receptor superfamily of nuclear transcriptional regulators. This receptor localizes to the cytoplasm and to subnuclear compartments. It binds retinoic acid, the biologically active form of vitamin A which mediates cellular signalling in embryonic morphogenesis, cell growth and differentiation. It is thought that this protein limits growth of many cell types by regulating gene expression. The gene was first identified in a hepatocellular carcinoma where it flanks a hepatitis B virus integration site. Alternate promoter usage and differential splicing result in multiple transcript variants. [provided by RefSeq, Mar 2014]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.
Facebook
LinkedIn
Twitter
