Human HINT2/HIT-17 ORF/cDNA clone-Lentivirus plasmid (NM_032593)
Pre-made Human HINT2/HIT-17 Lentiviral expression plasmid for HINT2 lentivirus packaging, HINT2 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go
to HINT2/HIT-17 products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Plasmid Grade | Plasmid quantity |
---|---|---|---|
pGMLP000713 | Human HINT2 Lentivirus plasmid | Research Grade | 10mg, 50mg, 100mg, 500mg, >1g |
GMP-like Grade | 10mg, 50mg, 100mg, 500mg, >1g | ||
High Quality (HQ) Grade | |||
Seed | 5ug |
Product Description
Catalog ID | pGMLP000713 |
Gene Name | HINT2 |
Accession Number | NM_032593 |
Gene ID | 84681 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 492 bp |
Gene Alias | HIT-17 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGGCGGCAGCCGTGGTGCTGGCTGCTGGGTTGCGCGCGGCGCGCAGAGCCGTGGCGGCCACGGGGGTGCGCGGGGGGCAGGTCCGAGGAGCTGCAGGTGTGACTGATGGGAATGAAGTGGCCAAGGCCCAGCAGGCAACTCCTGGGGGAGCAGCCCCAACCATCTTCTCCCGGATCCTGGACAAGAGCCTCCCAGCTGACATTCTCTATGAGGACCAGCAGTGTCTTGTGTTCCGTGATGTGGCCCCTCAGGCTCCTGTGCACTTCCTGGTCATTCCTAAGAAGCCCATTCCTCGGATTAGCCAGGCTGAAGAAGAAGACCAGCAGCTTCTAGGACACCTACTCCTTGTGGCCAAGCAGACAGCAAAGGCTGAGGGCCTGGGAGATGGATACCGACTTGTGATCAACGATGGGAAGCTGGGTGCACAATCTGTGTATCATCTGCACATTCATGTACTTGGGGGCCGGCAGCTCCAGTGGCCTCCAGGTTGA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-SE1506-Ab | Anti-HINT2/ HIT-17 functional antibody |
Target Antigen | GM-Tg-g-SE1506-Ag | HINT2 protein |
ORF Viral Vector | pGMPC000162 | Human HINT2 Mammalian (Non-Viral Vector) plasmid |
ORF Viral Vector | pGMLP000713 | Human HINT2 Lentivirus plasmid |
ORF Viral Vector | vGMLP000713 | Human HINT2 Lentivirus particle |
Target information
Target ID | GM-SE1506 |
Target Name | HINT2 |
Gene ID | 84681, 68917, 695521, 313491, 101094547, 481599, 281816, 106782580 |
Gene Symbol and Synonyms | 1190005L05Rik,HINT2,HIT-17 |
Uniprot Accession | Q9BX68 |
Uniprot Entry Name | HINT2_HUMAN |
Protein Sub-location | Secreted Protein/Potential Cytokines |
Category | Not Available |
Disease | Not Available |
Gene Ensembl | ENSG00000137133 |
Target Classification | Not Available |
Histidine triad proteins, such as HINT2, are nucleotide hydrolases and transferases that act on the alpha-phosphate of ribonucleotides (Brenner, 2002 [PubMed 12119013]).[supplied by OMIM, Mar 2008]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.