Human HINT2/HIT-17 ORF/cDNA clone-Mammalian (Non-Viral Vector) plasmid (NM_032593.3)

Pre-made Human HINT2/HIT-17 Non-Viral expression plasmid (overexpression vector) for mouse HINT2 overexpression in unique cell transient transfection and stable cell line development.

Target products collectionGo to HINT2/HIT-17 products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMPC000162 Human HINT2 Mammalian (Non-Viral Vector) plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMPC000162
Gene Name HINT2
Accession Number NM_032593.3
Gene ID 84681
Species Human
Product Type Mammalian (Non-Viral Vector) plasmid (overexpression)
Insert Length 492 bp
Gene Alias HIT-17
Fluorescent Reporter EGFP
Mammalian Cell Selection
Fusion Tag HA(C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGGCGGCAGCCGTGGTGCTGGCTGCTGGGTTGCGCGCGGCGCGCAGAGCCGTGGCGGCCACGGGGGTGCGCGGGGGGCAGGTCCGAGGAGCTGCAGGTGTGACTGATGGGAATGAAGTGGCCAAGGCCCAGCAGGCAACTCCTGGGGGAGCAGCCCCAACCATCTTCTCCCGGATCCTGGACAAGAGCCTCCCAGCTGACATTCTCTATGAGGACCAGCAGTGTCTTGTGTTCCGTGATGTGGCCCCTCAGGCTCCTGTGCACTTCCTGGTCATTCCTAAGAAGCCCATTCCTCGGATTAGCCAGGCTGAAGAAGAAGACCAGCAGCTTCTAGGACACCTACTCCTTGTGGCCAAGCAGACAGCAAAGGCTGAGGGCCTGGGAGATGGATACCGACTTGTGATCAACGATGGGAAGCTGGGTGCACAATCTGTGTATCATCTGCACATTCATGTACTTGGGGGCCGGCAGCTCCAGTGGCCTCCAGGTTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE1506-Ab Anti-HINT2/ HIT-17 functional antibody
    Target Antigen GM-Tg-g-SE1506-Ag HINT2 protein
    ORF Viral Vector pGMPC000162 Human HINT2 Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector pGMLP000713 Human HINT2 Lentivirus plasmid
    ORF Viral Vector vGMLP000713 Human HINT2 Lentivirus particle


    Target information

    Target ID GM-SE1506
    Target Name HINT2
    Gene ID 84681, 68917, 695521, 313491, 101094547, 481599, 281816, 106782580
    Gene Symbol and Synonyms 1190005L05Rik,HINT2,HIT-17
    Uniprot Accession Q9BX68
    Uniprot Entry Name HINT2_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000137133
    Target Classification Not Available

    Histidine triad proteins, such as HINT2, are nucleotide hydrolases and transferases that act on the alpha-phosphate of ribonucleotides (Brenner, 2002 [PubMed 12119013]).[supplied by OMIM, Mar 2008]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.