Human HINT2/HIT-17 ORF/cDNA clone-Lentivirus particle (NM_032593)

Pre-made Human HINT2/HIT-17 Lentiviral expression plasmid for HINT2 lentivirus packaging, HINT2 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collectionGo to HINT2/HIT-17 products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP000713 Human HINT2 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP000713
Gene Name HINT2
Accession Number NM_032593
Gene ID 84681
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 492 bp
Gene Alias HIT-17
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGGCGGCAGCCGTGGTGCTGGCTGCTGGGTTGCGCGCGGCGCGCAGAGCCGTGGCGGCCACGGGGGTGCGCGGGGGGCAGGTCCGAGGAGCTGCAGGTGTGACTGATGGGAATGAAGTGGCCAAGGCCCAGCAGGCAACTCCTGGGGGAGCAGCCCCAACCATCTTCTCCCGGATCCTGGACAAGAGCCTCCCAGCTGACATTCTCTATGAGGACCAGCAGTGTCTTGTGTTCCGTGATGTGGCCCCTCAGGCTCCTGTGCACTTCCTGGTCATTCCTAAGAAGCCCATTCCTCGGATTAGCCAGGCTGAAGAAGAAGACCAGCAGCTTCTAGGACACCTACTCCTTGTGGCCAAGCAGACAGCAAAGGCTGAGGGCCTGGGAGATGGATACCGACTTGTGATCAACGATGGGAAGCTGGGTGCACAATCTGTGTATCATCTGCACATTCATGTACTTGGGGGCCGGCAGCTCCAGTGGCCTCCAGGTTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE1506-Ab Anti-HINT2/ HIT-17 functional antibody
    Target Antigen GM-Tg-g-SE1506-Ag HINT2 protein
    ORF Viral Vector pGMPC000162 Human HINT2 Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector pGMLP000713 Human HINT2 Lentivirus plasmid
    ORF Viral Vector vGMLP000713 Human HINT2 Lentivirus particle


    Target information

    Target ID GM-SE1506
    Target Name HINT2
    Gene ID 84681, 68917, 695521, 313491, 101094547, 481599, 281816, 106782580
    Gene Symbol and Synonyms 1190005L05Rik,HINT2,HIT-17
    Uniprot Accession Q9BX68
    Uniprot Entry Name HINT2_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000137133
    Target Classification Not Available

    Histidine triad proteins, such as HINT2, are nucleotide hydrolases and transferases that act on the alpha-phosphate of ribonucleotides (Brenner, 2002 [PubMed 12119013]).[supplied by OMIM, Mar 2008]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.