Human REN/HNFJ2 ORF/cDNA clone-Lentivirus plasmid (NM_000537)
Pre-made Human REN/HNFJ2 Lentiviral expression plasmid for REN lentivirus packaging, REN lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go
to REN/HNFJ2 products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Plasmid Grade | Plasmid quantity |
---|---|---|---|
pGMLP000714 | Human REN Lentivirus plasmid | Research Grade | 10mg, 50mg, 100mg, 500mg, >1g |
GMP-like Grade | 10mg, 50mg, 100mg, 500mg, >1g | ||
High Quality (HQ) Grade | |||
Seed | 5ug |
Product Description
Catalog ID | pGMLP000714 |
Gene Name | REN |
Accession Number | NM_000537 |
Gene ID | 5972 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 1221 bp |
Gene Alias | HNFJ2 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGGATGGATGGAGAAGGATGCCTCGCTGGGGACTGCTGCTGCTGCTCTGGGGCTCCTGTACCTTTGGTCTCCCGACAGACACCACCACCTTTAAACGGATCTTCCTCAAGAGAATGCCCTCAATCCGAGAAAGCCTGAAGGAACGAGGTGTGGACATGGCCAGGCTTGGTCCCGAGTGGAGCCAACCCATGAAGAGGCTGACACTTGGCAACACCACCTCCTCCGTGATCCTCACCAACTACATGGACACCCAGTACTATGGCGAGATTGGCATCGGCACCCCACCCCAGACCTTCAAAGTCGTCTTTGACACTGGTTCGTCCAATGTTTGGGTGCCCTCCTCCAAGTGCAGCCGTCTCTACACTGCCTGTGTGTATCACAAGCTCTTCGATGCTTCGGATTCCTCCAGCTACAAGCACAATGGAACAGAACTCACCCTCCGCTATTCAACAGGGACAGTCAGTGGCTTTCTCAGCCAGGACATCATCACCGTGGGTGGAATCACGGTGACACAGATGTTTGGAGAGGTCACGGAGATGCCCGCCTTACCCTTCATGCTGGCCGAGTTTGATGGGGTTGTGGGCATGGGCTTCATTGAACAGGCCATTGGCAGGGTCACCCCTATCTTCGACAACATCATCTCCCAAGGGGTGCTAAAAGAGGACGTCTTCTCTTTCTACTACAACAGAGATTCCGAGAATTCCCAATCGCTGGGAGGACAGATTGTGCTGGGAGGCAGCGACCCCCAGCATTACGAAGGGAATTTCCACTATATCAACCTCATCAAGACTGGTGTCTGGCAGATTCAAATGAAGGGGGTGTCTGTGGGGTCATCCACCTTGCTCTGTGAAGACGGCTGCCTGGCATTGGTAGACACCGGTGCATCCTACATCTCAGGTTCTACCAGCTCCATAGAGAAGCTCATGGAGGCCTTGGGAGCCAAGAAGAGGCTGTTTGATTATGTCGTGAAGTGTAACGAGGGCCCTACACTCCCCGACATCTCTTTCCACCTGGGAGGCAAAGAATACACGCTCACCAGCGCGGACTATGTATTTCAGGAATCCTACAGTAGTAAAAAGCTGTGCACACTGGCCATCCACGCCATGGATATCCCGCCACCCACTGGACCCACCTGGGCCCTGGGGGCCACCTTCATCCGAAAGTTCTACACAGAGTTTGATCGGCGTAACAACCGCATTGGCTTCGCCTTGGCCCGCTGA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T61622-Ab | Anti-RENI/ REN/ HNFJ2 monoclonal antibody |
Target Antigen | GM-Tg-g-T61622-Ag | REN VLP (virus-like particle) |
ORF Viral Vector | pGMLP000714 | Human REN Lentivirus plasmid |
ORF Viral Vector | vGMLP000714 | Human REN Lentivirus particle |
Target information
Target ID | GM-T61622 |
Target Name | REN |
Gene ID | 5972, 19701, 574299, 24715, 101081695, 403838, 280909, 100054248 |
Gene Symbol and Synonyms | ADTKD4,HNFJ2,RATRENAA,REN,Ren-1,Ren-A,Ren1,Ren1c,Ren1d,RENAA,Rn-1,Rnr,RTD |
Uniprot Accession | P00797 |
Uniprot Entry Name | RENI_HUMAN |
Protein Sub-location | Transmembrane Protein |
Category | Therapeutics Target |
Disease | Lung Cancer, Sepsis |
Gene Ensembl | ENSG00000143839 |
Target Classification | Not Available |
This gene encodes renin, an aspartic protease that is secreted by the kidneys. Renin is a part of the renin-angiotensin-aldosterone system involved in regulation of blood pressure, and electrolyte balance. This enzyme catalyzes the first step in the activation pathway of angiotensinogen by cleaving angiotensinogen to form angiotensin I, which is then converted to angiotensin II by angiotensin I converting enzyme. This cascade can result in aldosterone release, narrowing of blood vessels, and increase in blood pressure as angiotension II is a vasoconstrictive peptide. Transcript variants that encode different protein isoforms and that arise from alternative splicing and the use of alternative promoters have been described, but their full-length nature has not been determined. Mutations in this gene have been shown to cause hyperuricemic nephropathy familial juvenile 2, familial hyperproreninemia, and renal tubular dysgenesis. [provided by RefSeq, May 2020]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.