Human REN/HNFJ2 ORF/cDNA clone-Lentivirus plasmid (NM_000537)

Pre-made Human REN/HNFJ2 Lentiviral expression plasmid for REN lentivirus packaging, REN lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

Target products collectionGo to REN/HNFJ2 products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMLP000714 Human REN Lentivirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMLP000714
Gene Name REN
Accession Number NM_000537
Gene ID 5972
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 1221 bp
Gene Alias HNFJ2
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGGATGGATGGAGAAGGATGCCTCGCTGGGGACTGCTGCTGCTGCTCTGGGGCTCCTGTACCTTTGGTCTCCCGACAGACACCACCACCTTTAAACGGATCTTCCTCAAGAGAATGCCCTCAATCCGAGAAAGCCTGAAGGAACGAGGTGTGGACATGGCCAGGCTTGGTCCCGAGTGGAGCCAACCCATGAAGAGGCTGACACTTGGCAACACCACCTCCTCCGTGATCCTCACCAACTACATGGACACCCAGTACTATGGCGAGATTGGCATCGGCACCCCACCCCAGACCTTCAAAGTCGTCTTTGACACTGGTTCGTCCAATGTTTGGGTGCCCTCCTCCAAGTGCAGCCGTCTCTACACTGCCTGTGTGTATCACAAGCTCTTCGATGCTTCGGATTCCTCCAGCTACAAGCACAATGGAACAGAACTCACCCTCCGCTATTCAACAGGGACAGTCAGTGGCTTTCTCAGCCAGGACATCATCACCGTGGGTGGAATCACGGTGACACAGATGTTTGGAGAGGTCACGGAGATGCCCGCCTTACCCTTCATGCTGGCCGAGTTTGATGGGGTTGTGGGCATGGGCTTCATTGAACAGGCCATTGGCAGGGTCACCCCTATCTTCGACAACATCATCTCCCAAGGGGTGCTAAAAGAGGACGTCTTCTCTTTCTACTACAACAGAGATTCCGAGAATTCCCAATCGCTGGGAGGACAGATTGTGCTGGGAGGCAGCGACCCCCAGCATTACGAAGGGAATTTCCACTATATCAACCTCATCAAGACTGGTGTCTGGCAGATTCAAATGAAGGGGGTGTCTGTGGGGTCATCCACCTTGCTCTGTGAAGACGGCTGCCTGGCATTGGTAGACACCGGTGCATCCTACATCTCAGGTTCTACCAGCTCCATAGAGAAGCTCATGGAGGCCTTGGGAGCCAAGAAGAGGCTGTTTGATTATGTCGTGAAGTGTAACGAGGGCCCTACACTCCCCGACATCTCTTTCCACCTGGGAGGCAAAGAATACACGCTCACCAGCGCGGACTATGTATTTCAGGAATCCTACAGTAGTAAAAAGCTGTGCACACTGGCCATCCACGCCATGGATATCCCGCCACCCACTGGACCCACCTGGGCCCTGGGGGCCACCTTCATCCGAAAGTTCTACACAGAGTTTGATCGGCGTAACAACCGCATTGGCTTCGCCTTGGCCCGCTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T61622-Ab Anti-RENI/ REN/ HNFJ2 monoclonal antibody
    Target Antigen GM-Tg-g-T61622-Ag REN VLP (virus-like particle)
    ORF Viral Vector pGMLP000714 Human REN Lentivirus plasmid
    ORF Viral Vector vGMLP000714 Human REN Lentivirus particle


    Target information

    Target ID GM-T61622
    Target Name REN
    Gene ID 5972, 19701, 574299, 24715, 101081695, 403838, 280909, 100054248
    Gene Symbol and Synonyms ADTKD4,HNFJ2,RATRENAA,REN,Ren-1,Ren-A,Ren1,Ren1c,Ren1d,RENAA,Rn-1,Rnr,RTD
    Uniprot Accession P00797
    Uniprot Entry Name RENI_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target
    Disease Lung Cancer, Sepsis
    Gene Ensembl ENSG00000143839
    Target Classification Not Available

    This gene encodes renin, an aspartic protease that is secreted by the kidneys. Renin is a part of the renin-angiotensin-aldosterone system involved in regulation of blood pressure, and electrolyte balance. This enzyme catalyzes the first step in the activation pathway of angiotensinogen by cleaving angiotensinogen to form angiotensin I, which is then converted to angiotensin II by angiotensin I converting enzyme. This cascade can result in aldosterone release, narrowing of blood vessels, and increase in blood pressure as angiotension II is a vasoconstrictive peptide. Transcript variants that encode different protein isoforms and that arise from alternative splicing and the use of alternative promoters have been described, but their full-length nature has not been determined. Mutations in this gene have been shown to cause hyperuricemic nephropathy familial juvenile 2, familial hyperproreninemia, and renal tubular dysgenesis. [provided by RefSeq, May 2020]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.