Human THRB/C-ERBA-2/ C-ERBA-BETA ORF/cDNA clone-Lentivirus plasmid (NM_001354713.1)

Pre-made Human THRB/C-ERBA-2/ C-ERBA-BETA Lentiviral expression plasmid for THRB lentivirus packaging, THRB lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

Target products collectionGo to THRB/C-ERBA-2 products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMLP000779 Human THRB Lentivirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMLP000779
Gene Name THRB
Accession Number NM_001354713.1
Gene ID 7068
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 1386 bp
Gene Alias C-ERBA-2, C-ERBA-BETA, ERBA2, GRTH, NR1A2, PRTH, THR1, THRB1, THRB2
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGACTCCCAACAGTATGACAGAAAATGGCCTTACAGCCTGGGACAAACCGAAGCACTGTCCAGACCGAGAACACGACTGGAAGCTAGTAGGAATGTCTGAAGCCTGCCTACATAGGAAGAGCCATTCAGAGAGGCGCAGCACGTTGAAAAATGAACAGTCGTCGCCACATCTCATCCAGACCACTTGGACTAGCTCAATATTCCATCTGGACCATGATGATGTGAACGACCAGAGTGTCTCAAGTGCCCAGACCTTCCAAACGGAGGAGAAGAAATGTAAAGGGTACATCCCCAGTTACTTAGACAAGGACGAGCTCTGTGTAGTGTGTGGTGACAAAGCCACCGGGTATCACTACCGCTGTATCACGTGTGAAGGCTGCAAGGGTTTCTTTAGAAGAACCATTCAGAAAAATCTCCATCCATCCTATTCCTGTAAATATGAAGGAAAATGTGTCATAGACAAAGTCACGCGAAATCAGTGCCAGGAATGTCGCTTTAAGAAATGCATCTATGTTGGCATGGCAACAGATTTGGTGCTGGATGACAGCAAGAGGCTGGCCAAGAGGAAGCTGATAGAGGAGAACCGGGAGAAAAGACGGCGGGAAGAGCTGCAGAAGTCCATCGGGCACAAGCCAGAGCCCACAGACGAGGAATGGGAGCTCATCAAAACTGTCACCGAAGCCCATGTGGCGACCAACGCCCAAGGCAGCCACTGGAAGCAAAAACGGAAATTCCTGCCAGAAGACATTGGACAAGCACCAATAGTCAATGCCCCAGAAGGTGGAAAGGTTGACTTGGAAGCCTTCAGCCATTTTACAAAAATCATCACACCAGCAATTACCAGAGTGGTGGATTTTGCCAAAAAGTTGCCTATGTTTTGTGAGCTGCCATGTGAAGACCAGATCATCCTCCTCAAAGGCTGCTGCATGGAGATCATGTCCCTTCGCGCTGCTGTGCGCTATGACCCAGAAAGTGAGACTTTAACCTTGAATGGGGAAATGGCAGTGACACGGGGCCAGCTGAAAAATGGGGGTCTTGGGGTGGTGTCAGACGCCATCTTTGACCTGGGCATGTCTCTGTCTTCTTTCAACCTGGATGACACTGAAGTAGCCCTCCTTCAGGCCGTCCTGCTGATGTCTTCAGATCGCCCGGGGCTTGCCTGTGTTGAGAGAATAGAAAAGTACCAAGATAGTTTCCTGCTGGCCTTTGAACACTATATCAATTACCGAAAACACCACGTGACACACTTTTGGCCAAAACTCCTGATGAAGGTGACAGATCTGCGGATGATAGGAGCCTGCCATGCCAGCCGCTTCCTGCACATGAAGGTGGAATGCCCCACAGAACTCTTCCCCCCTTTGTTCTTGGAAGTGTTCGAGGATTAG

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T98933-Ab Anti-THRB monoclonal antibody
    Target Antigen GM-Tg-g-T98933-Ag THRB protein
    ORF Viral Vector pGMLP000779 Human THRB Lentivirus plasmid
    ORF Viral Vector vGMLP000779 Human THRB Lentivirus particle


    Target information

    Target ID GM-T98933
    Target Name THRB
    Gene ID 7068, 21834, 100429549, 24831, 101084821, 403599, 788329, 100051615
    Gene Symbol and Synonyms C-ERBA-2,C-ERBA-BETA,c-erbAbeta,ERBA2,GRTH,NR1A2,PRTH,RATT3REC,T3Rbeta,T3rec,T3R[b],THR,THR1,THRB,THRB1,THRB2,THRbeta,THRbeta1,Thrbeta2,TRb,TRbeta,TRbeta1
    Uniprot Accession P10828
    Uniprot Entry Name THB_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Therapeutics Target
    Disease Cancer
    Gene Ensembl ENSG00000151090
    Target Classification Nuclear Receptors, Tumor-associated antigen (TAA)

    The protein encoded by this gene is a nuclear hormone receptor for triiodothyronine. It is one of the several receptors for thyroid hormone, and has been shown to mediate the biological activities of thyroid hormone. Knockout studies in mice suggest that the different receptors, while having certain extent of redundancy, may mediate different functions of thyroid hormone. Mutations in this gene are known to be a cause of generalized thyroid hormone resistance (GTHR), a syndrome characterized by goiter and high levels of circulating thyroid hormone (T3-T4), with normal or slightly elevated thyroid stimulating hormone (TSH). Several alternatively spliced transcript variants encoding the same protein have been observed for this gene. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.