Human THRB/C-ERBA-2/ C-ERBA-BETA ORF/cDNA clone-Lentivirus plasmid (NM_001354713.1)
Pre-made Human THRB/C-ERBA-2/ C-ERBA-BETA Lentiviral expression plasmid for THRB lentivirus packaging, THRB lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go
to THRB/C-ERBA-2 products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Plasmid Grade | Plasmid quantity |
---|---|---|---|
pGMLP000779 | Human THRB Lentivirus plasmid | Research Grade | 10mg, 50mg, 100mg, 500mg, >1g |
GMP-like Grade | 10mg, 50mg, 100mg, 500mg, >1g | ||
High Quality (HQ) Grade | |||
Seed | 5ug |
Product Description
Catalog ID | pGMLP000779 |
Gene Name | THRB |
Accession Number | NM_001354713.1 |
Gene ID | 7068 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 1386 bp |
Gene Alias | C-ERBA-2, C-ERBA-BETA, ERBA2, GRTH, NR1A2, PRTH, THR1, THRB1, THRB2 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGACTCCCAACAGTATGACAGAAAATGGCCTTACAGCCTGGGACAAACCGAAGCACTGTCCAGACCGAGAACACGACTGGAAGCTAGTAGGAATGTCTGAAGCCTGCCTACATAGGAAGAGCCATTCAGAGAGGCGCAGCACGTTGAAAAATGAACAGTCGTCGCCACATCTCATCCAGACCACTTGGACTAGCTCAATATTCCATCTGGACCATGATGATGTGAACGACCAGAGTGTCTCAAGTGCCCAGACCTTCCAAACGGAGGAGAAGAAATGTAAAGGGTACATCCCCAGTTACTTAGACAAGGACGAGCTCTGTGTAGTGTGTGGTGACAAAGCCACCGGGTATCACTACCGCTGTATCACGTGTGAAGGCTGCAAGGGTTTCTTTAGAAGAACCATTCAGAAAAATCTCCATCCATCCTATTCCTGTAAATATGAAGGAAAATGTGTCATAGACAAAGTCACGCGAAATCAGTGCCAGGAATGTCGCTTTAAGAAATGCATCTATGTTGGCATGGCAACAGATTTGGTGCTGGATGACAGCAAGAGGCTGGCCAAGAGGAAGCTGATAGAGGAGAACCGGGAGAAAAGACGGCGGGAAGAGCTGCAGAAGTCCATCGGGCACAAGCCAGAGCCCACAGACGAGGAATGGGAGCTCATCAAAACTGTCACCGAAGCCCATGTGGCGACCAACGCCCAAGGCAGCCACTGGAAGCAAAAACGGAAATTCCTGCCAGAAGACATTGGACAAGCACCAATAGTCAATGCCCCAGAAGGTGGAAAGGTTGACTTGGAAGCCTTCAGCCATTTTACAAAAATCATCACACCAGCAATTACCAGAGTGGTGGATTTTGCCAAAAAGTTGCCTATGTTTTGTGAGCTGCCATGTGAAGACCAGATCATCCTCCTCAAAGGCTGCTGCATGGAGATCATGTCCCTTCGCGCTGCTGTGCGCTATGACCCAGAAAGTGAGACTTTAACCTTGAATGGGGAAATGGCAGTGACACGGGGCCAGCTGAAAAATGGGGGTCTTGGGGTGGTGTCAGACGCCATCTTTGACCTGGGCATGTCTCTGTCTTCTTTCAACCTGGATGACACTGAAGTAGCCCTCCTTCAGGCCGTCCTGCTGATGTCTTCAGATCGCCCGGGGCTTGCCTGTGTTGAGAGAATAGAAAAGTACCAAGATAGTTTCCTGCTGGCCTTTGAACACTATATCAATTACCGAAAACACCACGTGACACACTTTTGGCCAAAACTCCTGATGAAGGTGACAGATCTGCGGATGATAGGAGCCTGCCATGCCAGCCGCTTCCTGCACATGAAGGTGGAATGCCCCACAGAACTCTTCCCCCCTTTGTTCTTGGAAGTGTTCGAGGATTAG |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T98933-Ab | Anti-THRB monoclonal antibody |
Target Antigen | GM-Tg-g-T98933-Ag | THRB protein |
ORF Viral Vector | pGMLP000779 | Human THRB Lentivirus plasmid |
ORF Viral Vector | vGMLP000779 | Human THRB Lentivirus particle |
Target information
Target ID | GM-T98933 |
Target Name | THRB |
Gene ID | 7068, 21834, 100429549, 24831, 101084821, 403599, 788329, 100051615 |
Gene Symbol and Synonyms | C-ERBA-2,C-ERBA-BETA,c-erbAbeta,ERBA2,GRTH,NR1A2,PRTH,RATT3REC,T3Rbeta,T3rec,T3R[b],THR,THR1,THRB,THRB1,THRB2,THRbeta,THRbeta1,Thrbeta2,TRb,TRbeta,TRbeta1 |
Uniprot Accession | P10828 |
Uniprot Entry Name | THB_HUMAN |
Protein Sub-location | Introcelluar Protein |
Category | Therapeutics Target |
Disease | Cancer |
Gene Ensembl | ENSG00000151090 |
Target Classification | Nuclear Receptors, Tumor-associated antigen (TAA) |
The protein encoded by this gene is a nuclear hormone receptor for triiodothyronine. It is one of the several receptors for thyroid hormone, and has been shown to mediate the biological activities of thyroid hormone. Knockout studies in mice suggest that the different receptors, while having certain extent of redundancy, may mediate different functions of thyroid hormone. Mutations in this gene are known to be a cause of generalized thyroid hormone resistance (GTHR), a syndrome characterized by goiter and high levels of circulating thyroid hormone (T3-T4), with normal or slightly elevated thyroid stimulating hormone (TSH). Several alternatively spliced transcript variants encoding the same protein have been observed for this gene. [provided by RefSeq, Jul 2008]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.