Human ALAD/ALADH/ PBGS ORF/cDNA clone-Lentivirus plasmid (NM_000031)

Pre-made Human ALAD/ALADH/ PBGS Lentiviral expression plasmid for ALAD lentivirus packaging, ALAD lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

Target products collectionGo to ALAD/ALADH products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMLP000780 Human ALAD Lentivirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMLP000780
Gene Name ALAD
Accession Number NM_000031
Gene ID 210
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 993 bp
Gene Alias ALADH, PBGS
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGCAGCCCCAGTCCGTTCTGCACAGCGGCTACTTCCACCCACTACTTCGGGCCTGGCAGACAGCCACCACCACCCTCAATGCCTCCAACCTCATCTACCCCATCTTTGTCACGGATGTTCCTGATGACATACAGCCTATCACCAGCCTCCCAGGAGTGGCCAGGTATGGTGTGAAGCGGCTGGAAGAGATGCTGAGGCCCTTGGTGGAAGAGGGCCTACGCTGTGTCTTGATCTTTGGCGTCCCCAGCAGAGTTCCCAAGGACGAGCGGGGTTCCGCAGCTGACTCCGAGGAGTCCCCAGCTATTGAGGCAATCCATCTGTTGAGGAAGACCTTCCCCAACCTCCTGGTGGCCTGTGATGTCTGCCTGTGTCCCTACACCTCCCATGGTCACTGCGGGCTCCTGAGTGAAAACGGAGCATTCCGGGCTGAGGAGAGCCGCCAGCGGCTGGCTGAGGTGGCATTGGCGTATGCCAAGGCAGGATGTCAGGTGGTAGCCCCGTCGGACATGATGGATGGACGCGTGGAAGCCATCAAAGAGGCCCTGATGGCACATGGACTTGGCAACAGGGTATCGGTGATGAGCTACAGTGCCAAATTTGCTTCCTGTTTCTATGGCCCTTTCCGGGATGCAGCTAAGTCAAGCCCAGCTTTTGGGGACCGCCGCTGCTACCAGCTGCCCCCTGGAGCACGAGGCCTGGCTCTCCGAGCTGTGGACCGGGATGTACGGGAAGGAGCTGACATGCTCATGGTGAAGCCGGGAATGCCCTACCTGGACATCGTGCGGGAGGTAAAGGACAAGCACCCTGACCTCCCTCTCGCCGTGTACCACGTCTCTGGAGAGTTTGCCATGCTGTGGCATGGAGCCCAGGCCGGGGCATTTGATCTCAAGGCTGCCGTACTGGAGGCCATGACTGCCTTCCGCAGAGCAGGTGCTGACATCATCATCACCTACTACACACCGCAGCTGCTGCAGTGGCTGAAGGAGGAATGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T20514-Ab Anti-ALAD monoclonal antibody
    Target Antigen GM-Tg-g-T20514-Ag ALAD protein
    ORF Viral Vector pGMLP000780 Human ALAD Lentivirus plasmid
    ORF Viral Vector vGMLP000780 Human ALAD Lentivirus particle


    Target information

    Target ID GM-T20514
    Target Name ALAD
    Gene ID 210, 17025, 705193, 25374, 101096680, 474808, 510679, 100052763
    Gene Symbol and Synonyms ALAD,ALADH,ALADR,aminolevulinatedelta-dehydratase,Lv,PBGS
    Uniprot Accession P13716
    Uniprot Entry Name HEM2_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Therapeutics Target
    Disease Not Available
    Gene Ensembl ENSG00000148218
    Target Classification Not Available

    The ALAD enzyme is composed of 8 identical subunits and catalyzes the condensation of 2 molecules of delta-aminolevulinate to form porphobilinogen (a precursor of heme, cytochromes and other hemoproteins). ALAD catalyzes the second step in the porphyrin and heme biosynthetic pathway; zinc is essential for enzymatic activity. ALAD enzymatic activity is inhibited by lead and a defect in the ALAD structural gene can cause increased sensitivity to lead poisoning and acute hepatic porphyria. Alternative splicing of this gene results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2015]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.