Human ALAD/ALADH/ PBGS ORF/cDNA clone-Lentivirus particle (NM_000031)
Pre-made Human ALAD/ALADH/ PBGS Lentiviral expression plasmid for ALAD lentivirus packaging, ALAD lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go
to ALAD/ALADH products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
---|---|---|---|
vGMLP000780 | Human ALAD Lentivirus particle | Pilot Grade | 1.0E+8TU |
5.0E+8TU | |||
1.0E+9TU | |||
Research Grade | 1.0E+8TU | ||
5.0E+8TU | |||
1.0E+9TU | |||
GMP-like Grade | inquiry | ||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMLP000780 |
Gene Name | ALAD |
Accession Number | NM_000031 |
Gene ID | 210 |
Species | Human |
Product Type | Lentivirus particle (overexpression) |
Insert Length | 993 bp |
Gene Alias | ALADH, PBGS |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGCAGCCCCAGTCCGTTCTGCACAGCGGCTACTTCCACCCACTACTTCGGGCCTGGCAGACAGCCACCACCACCCTCAATGCCTCCAACCTCATCTACCCCATCTTTGTCACGGATGTTCCTGATGACATACAGCCTATCACCAGCCTCCCAGGAGTGGCCAGGTATGGTGTGAAGCGGCTGGAAGAGATGCTGAGGCCCTTGGTGGAAGAGGGCCTACGCTGTGTCTTGATCTTTGGCGTCCCCAGCAGAGTTCCCAAGGACGAGCGGGGTTCCGCAGCTGACTCCGAGGAGTCCCCAGCTATTGAGGCAATCCATCTGTTGAGGAAGACCTTCCCCAACCTCCTGGTGGCCTGTGATGTCTGCCTGTGTCCCTACACCTCCCATGGTCACTGCGGGCTCCTGAGTGAAAACGGAGCATTCCGGGCTGAGGAGAGCCGCCAGCGGCTGGCTGAGGTGGCATTGGCGTATGCCAAGGCAGGATGTCAGGTGGTAGCCCCGTCGGACATGATGGATGGACGCGTGGAAGCCATCAAAGAGGCCCTGATGGCACATGGACTTGGCAACAGGGTATCGGTGATGAGCTACAGTGCCAAATTTGCTTCCTGTTTCTATGGCCCTTTCCGGGATGCAGCTAAGTCAAGCCCAGCTTTTGGGGACCGCCGCTGCTACCAGCTGCCCCCTGGAGCACGAGGCCTGGCTCTCCGAGCTGTGGACCGGGATGTACGGGAAGGAGCTGACATGCTCATGGTGAAGCCGGGAATGCCCTACCTGGACATCGTGCGGGAGGTAAAGGACAAGCACCCTGACCTCCCTCTCGCCGTGTACCACGTCTCTGGAGAGTTTGCCATGCTGTGGCATGGAGCCCAGGCCGGGGCATTTGATCTCAAGGCTGCCGTACTGGAGGCCATGACTGCCTTCCGCAGAGCAGGTGCTGACATCATCATCACCTACTACACACCGCAGCTGCTGCAGTGGCTGAAGGAGGAATGA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T20514-Ab | Anti-ALAD monoclonal antibody |
Target Antigen | GM-Tg-g-T20514-Ag | ALAD protein |
ORF Viral Vector | pGMLP000780 | Human ALAD Lentivirus plasmid |
ORF Viral Vector | vGMLP000780 | Human ALAD Lentivirus particle |
Target information
Target ID | GM-T20514 |
Target Name | ALAD |
Gene ID | 210, 17025, 705193, 25374, 101096680, 474808, 510679, 100052763 |
Gene Symbol and Synonyms | ALAD,ALADH,ALADR,aminolevulinatedelta-dehydratase,Lv,PBGS |
Uniprot Accession | P13716 |
Uniprot Entry Name | HEM2_HUMAN |
Protein Sub-location | Introcelluar Protein |
Category | Therapeutics Target |
Disease | Not Available |
Gene Ensembl | ENSG00000148218 |
Target Classification | Not Available |
The ALAD enzyme is composed of 8 identical subunits and catalyzes the condensation of 2 molecules of delta-aminolevulinate to form porphobilinogen (a precursor of heme, cytochromes and other hemoproteins). ALAD catalyzes the second step in the porphyrin and heme biosynthetic pathway; zinc is essential for enzymatic activity. ALAD enzymatic activity is inhibited by lead and a defect in the ALAD structural gene can cause increased sensitivity to lead poisoning and acute hepatic porphyria. Alternative splicing of this gene results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2015]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.