Human SST/SMST ORF/cDNA clone-Lentivirus plasmid (NM_001048)
Pre-made Human SST/SMST Lentiviral expression plasmid for SST lentivirus packaging, SST lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go
to SST/SMST products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Plasmid Grade | Plasmid quantity |
---|---|---|---|
pGMLP000833 | Human SST Lentivirus plasmid | Research Grade | 10mg, 50mg, 100mg, 500mg, >1g |
GMP-like Grade | 10mg, 50mg, 100mg, 500mg, >1g | ||
High Quality (HQ) Grade | |||
Seed | 5ug |
Product Description
Catalog ID | pGMLP000833 |
Gene Name | SST |
Accession Number | NM_001048 |
Gene ID | 6750 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 351 bp |
Gene Alias | SMST |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGCTGTCCTGCCGCCTCCAGTGCGCGCTGGCTGCGCTGTCCATCGTCCTGGCCCTGGGCTGTGTCACCGGCGCTCCCTCGGACCCCAGACTCCGTCAGTTTCTGCAGAAGTCCCTGGCTGCTGCCGCGGGGAAGCAGGAACTGGCCAAGTACTTCTTGGCAGAGCTGCTGTCTGAACCCAACCAGACGGAGAATGATGCCCTGGAACCTGAAGATCTGTCCCAGGCTGCTGAGCAGGATGAAATGAGGCTTGAGCTGCAGAGATCTGCTAACTCAAACCCGGCTATGGCACCCCGAGAACGCAAAGCTGGCTGCAAGAATTTCTTCTGGAAGACTTTCACATCCTGTTAG |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T95479-Ab | Anti-SMS/ SST/ SMST functional antibody |
Target Antigen | GM-Tg-g-T95479-Ag | SST protein |
ORF Viral Vector | pGMLP000833 | Human SST Lentivirus plasmid |
ORF Viral Vector | vGMLP000833 | Human SST Lentivirus particle |
Target information
Target ID | GM-T95479 |
Target Name | SST |
Gene ID | 6750, 20604, 708626, 24797, 101096911, 403993, 280932, 100059610 |
Gene Symbol and Synonyms | SMST,SOM,SRIF,SS,SS-14,SS-28,SST,SST1 |
Uniprot Accession | P61278 |
Uniprot Entry Name | SMS_HUMAN |
Protein Sub-location | Secreted Protein/Potential Cytokines |
Category | Therapeutics Target |
Disease | Esophagus Cancer, lung cancer |
Gene Ensembl | ENSG00000157005 |
Target Classification | Not Available |
The hormone somatostatin has active 14 aa and 28 aa forms that are produced by alternate cleavage of the single preproprotein encoded by this gene. Somatostatin is expressed throughout the body and inhibits the release of numerous secondary hormones by binding to high-affinity G-protein-coupled somatostatin receptors. This hormone is an important regulator of the endocrine system through its interactions with pituitary growth hormone, thyroid stimulating hormone, and most hormones of the gastrointestinal tract. Somatostatin also affects rates of neurotransmission in the central nervous system and proliferation of both normal and tumorigenic cells. [provided by RefSeq, Jul 2008]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.