Human SST/SMST ORF/cDNA clone-Lentivirus particle (NM_001048)

Pre-made Human SST/SMST Lentiviral expression plasmid for SST lentivirus packaging, SST lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collectionGo to SST/SMST products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP000833 Human SST Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP000833
Gene Name SST
Accession Number NM_001048
Gene ID 6750
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 351 bp
Gene Alias SMST
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGCTGTCCTGCCGCCTCCAGTGCGCGCTGGCTGCGCTGTCCATCGTCCTGGCCCTGGGCTGTGTCACCGGCGCTCCCTCGGACCCCAGACTCCGTCAGTTTCTGCAGAAGTCCCTGGCTGCTGCCGCGGGGAAGCAGGAACTGGCCAAGTACTTCTTGGCAGAGCTGCTGTCTGAACCCAACCAGACGGAGAATGATGCCCTGGAACCTGAAGATCTGTCCCAGGCTGCTGAGCAGGATGAAATGAGGCTTGAGCTGCAGAGATCTGCTAACTCAAACCCGGCTATGGCACCCCGAGAACGCAAAGCTGGCTGCAAGAATTTCTTCTGGAAGACTTTCACATCCTGTTAG

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T95479-Ab Anti-SMS/ SST/ SMST functional antibody
    Target Antigen GM-Tg-g-T95479-Ag SST protein
    ORF Viral Vector pGMLP000833 Human SST Lentivirus plasmid
    ORF Viral Vector vGMLP000833 Human SST Lentivirus particle


    Target information

    Target ID GM-T95479
    Target Name SST
    Gene ID 6750, 20604, 708626, 24797, 101096911, 403993, 280932, 100059610
    Gene Symbol and Synonyms SMST,SOM,SRIF,SS,SS-14,SS-28,SST,SST1
    Uniprot Accession P61278
    Uniprot Entry Name SMS_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Therapeutics Target
    Disease Esophagus Cancer, lung cancer
    Gene Ensembl ENSG00000157005
    Target Classification Not Available

    The hormone somatostatin has active 14 aa and 28 aa forms that are produced by alternate cleavage of the single preproprotein encoded by this gene. Somatostatin is expressed throughout the body and inhibits the release of numerous secondary hormones by binding to high-affinity G-protein-coupled somatostatin receptors. This hormone is an important regulator of the endocrine system through its interactions with pituitary growth hormone, thyroid stimulating hormone, and most hormones of the gastrointestinal tract. Somatostatin also affects rates of neurotransmission in the central nervous system and proliferation of both normal and tumorigenic cells. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.