Human FOLR1/FBP/ FOLR ORF/cDNA clone-Lentivirus plasmid (NM_016725)

Pre-made Human FOLR1/FBP/ FOLR Lentiviral expression plasmid for FOLR1 lentivirus packaging, FOLR1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

Target products collectionGo to FOLR1/FBP products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMLP000860 Human FOLR1 Lentivirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMLP000860
Gene Name FOLR1
Accession Number NM_016725
Gene ID 2348
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 774 bp
Gene Alias FBP, FOLR
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGGCTCAGCGGATGACAACACAGCTGCTGCTCCTTCTAGTGTGGGTGGCTGTAGTAGGGGAGGCTCAGACAAGGATTGCATGGGCCAGGACTGAGCTTCTCAATGTCTGCATGAACGCCAAGCACCACAAGGAAAAGCCAGGCCCCGAGGACAAGTTGCATGAGCAGTGTCGACCCTGGAGGAAGAATGCCTGCTGTTCTACCAACACCAGCCAGGAAGCCCATAAGGATGTTTCCTACCTATATAGATTCAACTGGAACCACTGTGGAGAGATGGCACCTGCCTGCAAACGGCATTTCATCCAGGACACCTGCCTCTACGAGTGCTCCCCCAACTTGGGGCCCTGGATCCAGCAGGTGGATCAGAGCTGGCGCAAAGAGCGGGTACTGAACGTGCCCCTGTGCAAAGAGGACTGTGAGCAATGGTGGGAAGATTGTCGCACCTCCTACACCTGCAAGAGCAACTGGCACAAGGGCTGGAACTGGACTTCAGGGTTTAACAAGTGCGCAGTGGGAGCTGCCTGCCAACCTTTCCATTTCTACTTCCCCACACCCACTGTTCTGTGCAATGAAATCTGGACTCACTCCTACAAGGTCAGCAACTACAGCCGAGGGAGTGGCCGCTGCATCCAGATGTGGTTCGACCCAGCCCAGGGCAACCCCAATGAGGAGGTGGCGAGGTTCTATGCTGCAGCCATGAGTGGGGCTGGGCCCTGGGCAGCCTGGCCTTTCCTGCTTAGCCTGGCCCTAATGCTGCTGTGGCTGCTCAGCTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Biosimilar GMP-Bios-INN-850 Pre-Made Farletuzumab Ecteribulin Biosimilar, Whole Mab Adc, Anti-Folr1 Antibody: Anti-FBP/FOLR/FRalpha/NCFTD therapeutic antibody Drug Conjugate
    Biosimilar GMP-Bios-ab-349 Pre-Made Mirvetuximab biosimilar, Whole mAb ADC, Anti-FOLR1 Antibody: Anti-FBP/FOLR/FRalpha/NCFTD therapeutic antibody
    Biosimilar GMP-Bios-INN-914 Pre-Made Mirvetuximab Soravtansine Biosimilar, Whole Mab Adc, Anti-Folr1 Antibody: Anti-FBP/FOLR/FRalpha/NCFTD therapeutic antibody Drug Conjugate
    Biosimilar GMP-Bios-ab-205 Pre-Made Farletuzumab biosimilar, Whole mAb, Anti-FOLR1 Antibody: Anti-FBP/FOLR/FRalpha/NCFTD therapeutic antibody
    Target Antibody GM-Tg-g-T83386-Ab Anti-FOLR1/ FBP/ FOLR monoclonal antibody
    Target Antigen GM-Tg-g-T83386-Ag FOLR1 VLP (virus-like particle)
    ORF Viral Vector pGMLP000860 Human FOLR1 Lentivirus plasmid
    ORF Viral Vector vGMLP000860 Human FOLR1 Lentivirus particle


    Target information

    Target ID GM-T83386
    Target Name FOLR1
    Gene ID 2348, 14275, 718388, 171049, 101084221, 539750, 100066084
    Gene Symbol and Synonyms FBP,FBP1,Folbp-1,Folbp1,FOLR,FOLR1,FRalpha,NCFTD
    Uniprot Accession P15328
    Uniprot Entry Name FOLR1_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target, Immuno-oncology Target, INN Index
    Disease Ovary Cancer
    Gene Ensembl ENSG00000110195
    Target Classification Checkpoint-Immuno Oncology

    The protein encoded by this gene is a member of the folate receptor family. Members of this gene family bind folic acid and its reduced derivatives, and transport 5-methyltetrahydrofolate into cells. This gene product is a secreted protein that either anchors to membranes via a glycosyl-phosphatidylinositol linkage or exists in a soluble form. Mutations in this gene have been associated with neurodegeneration due to cerebral folate transport deficiency. Due to the presence of two promoters, multiple transcription start sites, and alternative splicing, multiple transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Oct 2009]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.