Human FOLR1/FBP/ FOLR ORF/cDNA clone-Lentivirus plasmid (NM_016725)
Pre-made Human FOLR1/FBP/ FOLR Lentiviral expression plasmid for FOLR1 lentivirus packaging, FOLR1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go
to FOLR1/FBP products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Plasmid Grade | Plasmid quantity |
---|---|---|---|
pGMLP000860 | Human FOLR1 Lentivirus plasmid | Research Grade | 10mg, 50mg, 100mg, 500mg, >1g |
GMP-like Grade | 10mg, 50mg, 100mg, 500mg, >1g | ||
High Quality (HQ) Grade | |||
Seed | 5ug |
Product Description
Catalog ID | pGMLP000860 |
Gene Name | FOLR1 |
Accession Number | NM_016725 |
Gene ID | 2348 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 774 bp |
Gene Alias | FBP, FOLR |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGGCTCAGCGGATGACAACACAGCTGCTGCTCCTTCTAGTGTGGGTGGCTGTAGTAGGGGAGGCTCAGACAAGGATTGCATGGGCCAGGACTGAGCTTCTCAATGTCTGCATGAACGCCAAGCACCACAAGGAAAAGCCAGGCCCCGAGGACAAGTTGCATGAGCAGTGTCGACCCTGGAGGAAGAATGCCTGCTGTTCTACCAACACCAGCCAGGAAGCCCATAAGGATGTTTCCTACCTATATAGATTCAACTGGAACCACTGTGGAGAGATGGCACCTGCCTGCAAACGGCATTTCATCCAGGACACCTGCCTCTACGAGTGCTCCCCCAACTTGGGGCCCTGGATCCAGCAGGTGGATCAGAGCTGGCGCAAAGAGCGGGTACTGAACGTGCCCCTGTGCAAAGAGGACTGTGAGCAATGGTGGGAAGATTGTCGCACCTCCTACACCTGCAAGAGCAACTGGCACAAGGGCTGGAACTGGACTTCAGGGTTTAACAAGTGCGCAGTGGGAGCTGCCTGCCAACCTTTCCATTTCTACTTCCCCACACCCACTGTTCTGTGCAATGAAATCTGGACTCACTCCTACAAGGTCAGCAACTACAGCCGAGGGAGTGGCCGCTGCATCCAGATGTGGTTCGACCCAGCCCAGGGCAACCCCAATGAGGAGGTGGCGAGGTTCTATGCTGCAGCCATGAGTGGGGCTGGGCCCTGGGCAGCCTGGCCTTTCCTGCTTAGCCTGGCCCTAATGCTGCTGTGGCTGCTCAGCTGA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Biosimilar | GMP-Bios-INN-850 | Pre-Made Farletuzumab Ecteribulin Biosimilar, Whole Mab Adc, Anti-Folr1 Antibody: Anti-FBP/FOLR/FRalpha/NCFTD therapeutic antibody Drug Conjugate |
Biosimilar | GMP-Bios-ab-349 | Pre-Made Mirvetuximab biosimilar, Whole mAb ADC, Anti-FOLR1 Antibody: Anti-FBP/FOLR/FRalpha/NCFTD therapeutic antibody |
Biosimilar | GMP-Bios-INN-914 | Pre-Made Mirvetuximab Soravtansine Biosimilar, Whole Mab Adc, Anti-Folr1 Antibody: Anti-FBP/FOLR/FRalpha/NCFTD therapeutic antibody Drug Conjugate |
Biosimilar | GMP-Bios-ab-205 | Pre-Made Farletuzumab biosimilar, Whole mAb, Anti-FOLR1 Antibody: Anti-FBP/FOLR/FRalpha/NCFTD therapeutic antibody |
Target Antibody | GM-Tg-g-T83386-Ab | Anti-FOLR1/ FBP/ FOLR monoclonal antibody |
Target Antigen | GM-Tg-g-T83386-Ag | FOLR1 VLP (virus-like particle) |
ORF Viral Vector | pGMLP000860 | Human FOLR1 Lentivirus plasmid |
ORF Viral Vector | vGMLP000860 | Human FOLR1 Lentivirus particle |
Target information
Target ID | GM-T83386 |
Target Name | FOLR1 |
Gene ID | 2348, 14275, 718388, 171049, 101084221, 539750, 100066084 |
Gene Symbol and Synonyms | FBP,FBP1,Folbp-1,Folbp1,FOLR,FOLR1,FRalpha,NCFTD |
Uniprot Accession | P15328 |
Uniprot Entry Name | FOLR1_HUMAN |
Protein Sub-location | Transmembrane Protein |
Category | Therapeutics Target, Immuno-oncology Target, INN Index |
Disease | Ovary Cancer |
Gene Ensembl | ENSG00000110195 |
Target Classification | Checkpoint-Immuno Oncology |
The protein encoded by this gene is a member of the folate receptor family. Members of this gene family bind folic acid and its reduced derivatives, and transport 5-methyltetrahydrofolate into cells. This gene product is a secreted protein that either anchors to membranes via a glycosyl-phosphatidylinositol linkage or exists in a soluble form. Mutations in this gene have been associated with neurodegeneration due to cerebral folate transport deficiency. Due to the presence of two promoters, multiple transcription start sites, and alternative splicing, multiple transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Oct 2009]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.