Human CRK/CRKII/p38 ORF/cDNA clone-Lentivirus plasmid (NM_005206.4)
Cat. No.: pGMLP000979
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days
Pre-made Human CRK/CRKII/p38 Lentiviral expression plasmid for CRK lentivirus packaging, CRK lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go to
c-Crk/CRK/CRKII products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product Description
Catalog ID | pGMLP000979 |
Gene Name | CRK |
Accession Number | NM_005206.4 |
Gene ID | 1398 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 615 bp |
Gene Alias | CRKII,p38 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
ORF Nucleotide Sequence | ATGGCGGGCAACTTCGACTCGGAGGAGCGGAGTAGCTGGTACTGGGGGAGGTTGAGTCGGCAGGAGGCGGTGGCGCTGCTGCAGGGCCAGCGGCACGGGGTGTTCCTGGTGCGGGACTCGAGCACCAGCCCCGGGGACTATGTGCTCAGCGTCTCAGAGAACTCGCGCGTCTCCCACTACATCATCAACAGCAGCGGCCCGCGCCCGCCGGTGCCACCGTCGCCCGCCCAGCCTCCGCCCGGGGTGAGCCCCTCCAGACTCCGAATAGGAGATCAAGAGTTTGATTCATTGCCTGCTTTACTGGAATTCTACAAAATACACTATTTGGACACTACAACGTTGATAGAACCAGTTTCCAGATCCAGGCAGGGTAGTGGAGTGATTCTCAGGCAGGAGGAGGCGGAGTATGTGCGAGCCCTCTTTGACTTTAATGGGAATGATGAGGAAGATCTTCCCTTTAAGAAAGGAGACATCTTGAGAATCCGGGACAAGCCTGAAGAGCAGTGGTGGAATGCGGAGGACAGCGAAGGCAAGAGAGGGATGATTCCAGTCCCTTACGTCGAGAAGTATAGACCTGCCTCCGCCTCAGTATCGGCTCTGATTGGAGGTCGGTGA |
ORF Protein Sequence | MAGNFDSEERSSWYWGRLSRQEAVALLQGQRHGVFLVRDSSTSPGDYVLSVSENSRVSHYIINSSGPRPPVPPSPAQPPPGVSPSRLRIGDQEFDSLPALLEFYKIHYLDTTTLIEPVSRSRQGSGVILRQEEAEYVRALFDFNGNDEEDLPFKKGDILRIRDKPEEQWWNAEDSEGKRGMIPVPYVEKYRPASASVSALIGGR |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T27297-Ab | Anti-CRK/ c-Crk/ CRKII monoclonal antibody |
Target Antigen | GM-Tg-g-T27297-Ag | c-Crk/CRK VLP (virus-like particle) |
ORF Viral Vector | pGMLP000880 | Human CRK Lentivirus plasmid |
ORF Viral Vector | pGMLP000979 | Human CRK Lentivirus plasmid |
ORF Viral Vector | pGMLP001360 | Human CRK Lentivirus plasmid |
ORF Viral Vector | pGMAP-SPh-297 | Human CRK Adenovirus plasmid |
ORF Viral Vector | vGMLP000880 | Human CRK Lentivirus particle |
ORF Viral Vector | vGMLP000979 | Human CRK Lentivirus particle |
ORF Viral Vector | vGMLP001360 | Human CRK Lentivirus particle |
ORF Viral Vector | vGMAP-SPh-297 | Human CRK Adenovirus particle |
Target information
Target ID | GM-T27297 |
Target Name | c-Crk |
Gene ID | 1398, 12928, 701185, 54245, 101086100, 100684309, 512841, 100072356 |
Gene Symbol and Synonyms | c-Crk,CRK,Crk-I,Crk-II,Crk-III,Crk3,CRKII,CrkIII,Crko,p38 |
Uniprot Accession | P46108 |
Uniprot Entry Name | CRK_HUMAN |
Protein Sub-location | Transmembrane Protein |
Category | Therapeutics Target |
Disease | Cancer |
Gene Ensembl | ENSG00000167193 |
Target Classification | Tumor-associated antigen (TAA) |
This gene encodes a member of an adapter protein family that binds to several tyrosine-phosphorylated proteins. The product of this gene has several SH2 and SH3 domains (src-homology domains) and is involved in several signaling pathways, recruiting cytoplasmic proteins in the vicinity of tyrosine kinase through SH2-phosphotyrosine interaction. The N-terminal SH2 domain of this protein functions as a positive regulator of transformation whereas the C-terminal SH3 domain functions as a negative regulator of transformation. Two alternative transcripts encoding different isoforms with distinct biological activity have been described. [provided by RefSeq, Jul 2008]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.