Human CRK/CRKII/p38 ORF/cDNA clone-Lentivirus plasmid (NM_016823)

Cat. No.: pGMLP001360
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human CRK/CRKII/p38 Lentiviral expression plasmid for CRK lentivirus packaging, CRK lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

pdf Datasheet
pdf MSDS
pdf Terms of Use
Target products collection

Go to c-Crk/CRK/CRKII products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $528.75
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP001360
Gene Name CRK
Accession Number NM_016823
Gene ID 1398
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 915 bp
Gene Alias CRKII,p38
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGCGGGCAACTTCGACTCGGAGGAGCGGAGTAGCTGGTACTGGGGGAGGTTGAGTCGGCAGGAGGCGGTGGCGCTGCTGCAGGGCCAGCGGCACGGGGTGTTCCTGGTGCGGGACTCGAGCACCAGCCCCGGGGACTATGTGCTCAGCGTCTCAGAGAACTCGCGCGTCTCCCACTACATCATCAACAGCAGCGGCCCGCGCCCGCCGGTGCCACCGTCGCCCGCCCAGCCTCCGCCCGGGGTGAGCCCCTCCAGACTCCGAATAGGAGATCAAGAGTTTGATTCATTGCCTGCTTTACTGGAATTCTACAAAATACACTATTTGGACACTACAACGTTGATAGAACCAGTTTCCAGATCCAGGCAGGGTAGTGGAGTGATTCTCAGGCAGGAGGAGGCGGAGTATGTGCGAGCCCTCTTTGACTTTAATGGGAATGATGAGGAAGATCTTCCCTTTAAGAAAGGAGACATCTTGAGAATCCGGGACAAGCCTGAAGAGCAGTGGTGGAATGCGGAGGACAGCGAAGGCAAGAGAGGGATGATTCCAGTCCCTTACGTCGAGAAGTATAGACCTGCCTCCGCCTCAGTATCGGCTCTGATTGGAGGTAACCAGGAGGGTTCCCACCCACAGCCACTGGGTGGGCCGGAGCCTGGGCCCTATGCCCAACCCAGCGTCAACACTCCGCTCCCTAACCTCCAGAATGGGCCCATATATGCCAGGGTTATCCAGAAGCGAGTCCCCAATGCCTACGACAAGACAGCCTTGGCTTTGGAGGTCGGTGAGCTGGTAAAGGTTACGAAGATTAATGTGAGTGGTCAGTGGGAAGGGGAGTGTAATGGCAAACGAGGTCACTTCCCATTCACACATGTCCGTCTGCTGGATCAACAGAATCCCGATGAGGACTTCAGCTGA
ORF Protein Sequence MAGNFDSEERSSWYWGRLSRQEAVALLQGQRHGVFLVRDSSTSPGDYVLSVSENSRVSHYIINSSGPRPPVPPSPAQPPPGVSPSRLRIGDQEFDSLPALLEFYKIHYLDTTTLIEPVSRSRQGSGVILRQEEAEYVRALFDFNGNDEEDLPFKKGDILRIRDKPEEQWWNAEDSEGKRGMIPVPYVEKYRPASASVSALIGGNQEGSHPQPLGGPEPGPYAQPSVNTPLPNLQNGPIYARVIQKRVPNAYDKTALALEVGELVKVTKINVSGQWEGECNGKRGHFPFTHVRLLDQQNPDEDFS

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T27297-Ab Anti-CRK/ c-Crk/ CRKII monoclonal antibody
    Target Antigen GM-Tg-g-T27297-Ag c-Crk/CRK VLP (virus-like particle)
    ORF Viral Vector pGMLP000880 Human CRK Lentivirus plasmid
    ORF Viral Vector pGMLP000979 Human CRK Lentivirus plasmid
    ORF Viral Vector pGMLP001360 Human CRK Lentivirus plasmid
    ORF Viral Vector pGMAP-SPh-297 Human CRK Adenovirus plasmid
    ORF Viral Vector vGMLP000880 Human CRK Lentivirus particle
    ORF Viral Vector vGMLP000979 Human CRK Lentivirus particle
    ORF Viral Vector vGMLP001360 Human CRK Lentivirus particle
    ORF Viral Vector vGMAP-SPh-297 Human CRK Adenovirus particle


    Target information

    Target ID GM-T27297
    Target Name c-Crk
    Gene ID 1398, 12928, 701185, 54245, 101086100, 100684309, 512841, 100072356
    Gene Symbol and Synonyms c-Crk,CRK,Crk-I,Crk-II,Crk-III,Crk3,CRKII,CrkIII,Crko,p38
    Uniprot Accession P46108
    Uniprot Entry Name CRK_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target
    Disease Cancer
    Gene Ensembl ENSG00000167193
    Target Classification Tumor-associated antigen (TAA)

    This gene encodes a member of an adapter protein family that binds to several tyrosine-phosphorylated proteins. The product of this gene has several SH2 and SH3 domains (src-homology domains) and is involved in several signaling pathways, recruiting cytoplasmic proteins in the vicinity of tyrosine kinase through SH2-phosphotyrosine interaction. The N-terminal SH2 domain of this protein functions as a positive regulator of transformation whereas the C-terminal SH3 domain functions as a negative regulator of transformation. Two alternative transcripts encoding different isoforms with distinct biological activity have been described. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.