- • Up to 20%-50%* off first purchase
- • Bulk quantities available
- • Citation Reward application
Sample Application
- • Animal health test
- • In-vitro diagnostics
- • Food & Feed Safety
- • Environmental Safety
- • New drug discovery
Supports
- Talk to our Expert:
[email protected] -
Talk to our sales:
[email protected]
Protocol Library Download
 |
 |
Human CEP57/MVA2/ PIG8 ORF/cDNA clone-Lentivirus plasmid (NM_014679)
Pre-made Human CEP57/MVA2/ PIG8 Lentiviral expression plasmid for CEP57 lentivirus packaging, CEP57 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go
to CEP57/MVA2 products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
| Catalog No. | Product Name | Plasmid Grade | Plasmid quantity |
|---|---|---|---|
| pGMLP001070 | Human CEP57 Lentivirus plasmid | Research Grade | 10mg, 50mg, 100mg, 500mg, >1g |
| GMP-like Grade | 10mg, 50mg, 100mg, 500mg, >1g | ||
| High Quality (HQ) Grade | |||
| Seed | 5ug |
Product Description
| Catalog ID | pGMLP001070 |
| Gene Name | CEP57 |
| Accession Number | NM_014679 |
| Gene ID | 9702 |
| Species | Human |
| Product Type | Lentivirus plasmid (overexpression) |
| Insert Length | 1503 bp |
| Gene Alias | MVA2, PIG8, TSP57 |
| Fluorescent Reporter | ZsGreen |
| Mammalian Cell Selection | Puromyocin |
| Fusion Tag | 3xflag (C-Terminal) |
| Promoter | CMV |
| Resistance | Amplicin |
| Sequence | ATGGCGGCGGCGTCTGTCTCTGCGGCTTCTGGTTCTCACTTGTCGAACAGCTTTGCTGAGCCATCAAGGTCTAATGGAAGCATGGTTCGGCATTCTTCATCTCCATATGTAGTATATCCTTCGGATAAGCCTTTCCTTAATAGTGATCTACGACGCTCCCCAAGTAAGCCTACACTTGCCTATCCAGAAAGCAACAGCAGAGCCATATTTTCTGCTCTTAAGAATCTTCAAGATAAGATTCGACGCTTGGAACTTGAGAGGATTCAGGCAGAAGAAAGTGTGAAAACCTTGTCTAGAGAAACAATTGAATATAAGAAAGTACTGGATGAACAGATACAAGAAAGGGAGAATTCAAAGAATGAGGAATCAAAGCACAATCAAGAACTGACATCTCAGTTGTTAGCTGCAGAAAATAAATGCAATCTATTAGAAAAACAATTGGAATACATGCGAAATATGATAAAGCATGCCGAAATGGAGAGGACATCTGTCTTAGAGAAACAAGTTTCCCTAGAAAGAGAACGACAACATGATCAAACACATGTTCAGAGCCAACTTGAAAAATTGGATCTTCTTGAACAGGAGTATAACAAACTTACCACAATGCAGGCCCTTGCAGAAAAAAAAATGCAAGAGTTGGAAGCAAAACTCCATGAAGAAGAACAGGAAAGGAAACGCATGCAAGCTAAGGCAGCTGAGTTGCAGACTGGTCTAGAAACAAATAGACTTATCTTTGAAGATAAGGCAACTCCGTGTGTTCCCAATGCAAGAAGAATTAAAAAAAAGAAGTCAAAACCACCAGAAAAGAAAAGTTCTAGGAACTATTTTGGTGCACAACCACATTATAGATTATGCTTGGGTGATATGCCATTTGTAGCTGGGAAGTCCACAAGCCCTAGCCATGCCGTGGTAGCCAATGTTCAGCTTGTCTTGCATCTAATGAAGCAACACAGTAAAGCTTTGTGCAATGATCGAGTCATCAACAGTATTCCTTTGGCAAAGCAAGTATCTTCACGAGGTGGTAAAAGTAAGAAGTTGTCAGTAACACCTCCCTCCTCCAACGGTATTAATGAGGAGTTGTCAGAAGTCTTACAGACTTTACAGGATGAATTTGGGCAAATGAGCTTTGATCACCAGCAGCTTGCAAAACTTATCCAGGAGTCGCCAACCGTTGAACTGAAAGACAAGTTGGAGTGTGAATTGGAGGCATTAGTGGGAAGGATGGAAGCAAAAGCCAACCAAATAACTAAAGTTCGAAAATACCAAGCCCAGCTGGAGAAACAGAAGTTAGAGAAGCAGAAGAAGGAATTAAAAGCTACCAAAAAGACTCTTGATGAAGAAAGAAACAGCAGCAGCCGTTCTGGAATCACAGGGACCACAAATAAGAAAGATTTTATGAAACTGAGACCTGGAGAAAAAAGGAGAAAAAATCTTCAGTTATTGAAGGACATGCAAAGCATACAGAATTCATTACAAAGCAGTAGTTTGTGTTGGGATTACTGA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
| Category | Cat No. | Products Name |
|---|---|---|
| Target Antibody | GM-Tg-g-SE1572-Ab | Anti-CEP57/ MVA2/ PIG8 functional antibody |
| Target Antigen | GM-Tg-g-SE1572-Ag | CEP57 protein |
| ORF Viral Vector | pGMLP001070 | Human CEP57 Lentivirus plasmid |
| ORF Viral Vector | vGMLP001070 | Human CEP57 Lentivirus particle |
Target information
| Target ID | GM-SE1572 |
| Target Name | CEP57 |
| Gene ID | 9702, 74360, 699835, 315423, 101084902, 476766, 353245, 100067852 |
| Gene Symbol and Synonyms | 3110002L15Rik,4921510P06Rik,4931428M20Rik,CEP57,mKIAA0092,MVA2,PIG8,RGD1309884,TSP57 |
| Uniprot Accession | Q86XR8 |
| Uniprot Entry Name | CEP57_HUMAN |
| Protein Sub-location | Secreted Protein/Potential Cytokines |
| Category | Not Available |
| Disease | Not Available |
| Gene Ensembl | ENSG00000166037 |
| Target Classification | Not Available |
This gene encodes a cytoplasmic protein called Translokin. This protein localizes to the centrosome and has a function in microtubular stabilization. The N-terminal half of this protein is required for its centrosome localization and for its multimerization, and the C-terminal half is required for nucleating, bundling and anchoring microtubules to the centrosomes. This protein specifically interacts with fibroblast growth factor 2 (FGF2), sorting nexin 6, Ran-binding protein M and the kinesins KIF3A and KIF3B, and thus mediates the nuclear translocation and mitogenic activity of the FGF2. It also interacts with cyclin D1 and controls nucleocytoplasmic distribution of the cyclin D1 in quiescent cells. This protein is crucial for maintaining correct chromosomal number during cell division. Mutations in this gene cause mosaic variegated aneuploidy syndrome, a rare autosomal recessive disorder. Multiple alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Aug 2011]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.
Facebook
LinkedIn
Twitter
