Human FGF5/HBGF-5/ Smag-82 ORF/cDNA clone-Lentivirus plasmid (NM_004464)

Pre-made Human FGF5/HBGF-5/ Smag-82 Lentiviral expression plasmid for FGF5 lentivirus packaging, FGF5 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

Target products collectionGo to FGF5/HBGF-5 products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMLP001159 Human FGF5 Lentivirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMLP001159
Gene Name FGF5
Accession Number NM_004464
Gene ID 2250
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 807 bp
Gene Alias HBGF-5, Smag-82, TCMGLY
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGAGCTTGTCCTTCCTCCTCCTCCTCTTCTTCAGCCACCTGATCCTCAGCGCCTGGGCTCACGGGGAGAAGCGTCTCGCCCCCAAAGGGCAACCCGGACCCGCTGCCACTGATAGGAACCCTAGAGGCTCCAGCAGCAGACAGAGCAGCAGTAGCGCTATGTCTTCCTCTTCTGCCTCCTCCTCCCCCGCAGCTTCTCTGGGCAGCCAAGGAAGTGGCTTGGAGCAGAGCAGTTTCCAGTGGAGCCCCTCGGGGCGCCGGACCGGCAGCCTCTACTGCAGAGTGGGCATCGGTTTCCATCTGCAGATCTACCCGGATGGCAAAGTCAATGGATCCCACGAAGCCAATATGTTAAGTGTTTTGGAAATATTTGCTGTGTCTCAGGGGATTGTAGGAATACGAGGAGTTTTCAGCAACAAATTTTTAGCGATGTCAAAAAAAGGAAAACTCCATGCAAGTGCCAAGTTCACAGATGACTGCAAGTTCAGGGAGCGTTTTCAAGAAAATAGCTATAATACCTATGCCTCAGCAATACATAGAACTGAAAAAACAGGGCGGGAGTGGTATGTGGCCCTGAATAAAAGAGGAAAAGCCAAACGAGGGTGCAGCCCCCGGGTTAAACCCCAGCATATCTCTACCCATTTTCTGCCAAGATTCAAGCAGTCGGAGCAGCCAGAACTTTCTTTCACGGTTACTGTTCCTGAAAAGAAAAAGCCACCTAGCCCTATCAAGCCAAAGATTCCCCTTTCTGCACCTCGGAAAAATACCAACTCAGTGAAATACAGACTCAAGTTTCGCTTTGGATAA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE0922-Ab Anti-FGF5/ HBGF-5/ Smag-82 functional antibody
    Target Antigen GM-Tg-g-SE0922-Ag FGF5 protein
    Cytokine cks-Tg-g-GM-SE0922 fibroblast growth factor 5 (FGF5) protein & antibody
    ORF Viral Vector pGMLP001159 Human FGF5 Lentivirus plasmid
    ORF Viral Vector vGMLP001159 Human FGF5 Lentivirus particle


    Target information

    Target ID GM-SE0922
    Target Name FGF5
    Gene ID 2250, 14176, 695896, 60662, 100136904, 608459, 536771, 100060219
    Gene Symbol and Synonyms angora,Fgf-5,Fgf3a,FGF5,go,HBGF-5,Smag-82,TCMGLY
    Uniprot Accession P12034
    Uniprot Entry Name FGF5_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Cytokine Target
    Disease Not Available
    Gene Ensembl ENSG00000138675
    Target Classification Not Available

    The protein encoded by this gene is a member of the fibroblast growth factor (FGF) family. FGF family members possess broad mitogenic and cell survival activities, and are involved in a variety of biological processes, including embryonic development, cell growth, morphogenesis, tissue repair, tumor growth and invasion. This gene was identified as an oncogene, which confers transforming potential when transfected into mammalian cells. Targeted disruption of the homolog of this gene in mouse resulted in the phenotype of abnormally long hair, which suggested a function as an inhibitor of hair elongation. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.