Human EDN1/ARCND3/ ET1 ORF/cDNA clone-Lentivirus plasmid (NM_001955)

Pre-made Human EDN1/ARCND3/ ET1 Lentiviral expression plasmid for EDN1 lentivirus packaging, EDN1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

Target products collectionGo to EDN1/ARCND3 products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMLP001214 Human EDN1 Lentivirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMLP001214
Gene Name EDN1
Accession Number NM_001955
Gene ID 1906
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 639 bp
Gene Alias ARCND3, ET1, HDLCQ7, PPET1, QME
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGGATTATTTGCTCATGATTTTCTCTCTGCTGTTTGTGGCTTGCCAAGGAGCTCCAGAAACAGCAGTCTTAGGCGCTGAGCTCAGCGCGGTGGGTGAGAACGGCGGGGAGAAACCCACTCCCAGTCCACCCTGGCGGCTCCGCCGGTCCAAGCGCTGCTCCTGCTCGTCCCTGATGGATAAAGAGTGTGTCTACTTCTGCCACCTGGACATCATTTGGGTCAACACTCCCGAGCACGTTGTTCCGTATGGACTTGGAAGCCCTAGGTCCAAGAGAGCCTTGGAGAATTTACTTCCCACAAAGGCAACAGACCGTGAAAATAGATGCCAATGTGCTAGCCAAAAAGACAAGAAGTGCTGGAATTTTTGCCAAGCAGGAAAAGAACTCAGGGCTGAAGACATTATGGAGAAAGACTGGAATAATCATAAGAAAGGAAAAGACTGTTCCAAGCTTGGGAAAAAGTGTATTTATCAGCAGTTAGTGAGAGGAAGAAAAATCAGAAGAAGTTCAGAGGAACACCTAAGACAAACCAGGTCGGAGACCATGAGAAACAGCGTCAAATCATCTTTTCATGATCCCAAGCTGAAAGGCAAGCCCTCCAGAGAGCGTTATGTGACCCACAACCGAGCACATTGGTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T25076-Ab Anti-EDN1/ ARCND3/ ET1 functional antibody
    Target Antigen GM-Tg-g-T25076-Ag EDN1 protein
    ORF Viral Vector pGMLV000129 Rat Edn1 Lentivirus plasmid
    ORF Viral Vector pGMLP001214 Human EDN1 Lentivirus plasmid
    ORF Viral Vector vGMLV000129 Rat Edn1 Lentivirus particle
    ORF Viral Vector vGMLP001214 Human EDN1 Lentivirus particle


    Target information

    Target ID GM-T25076
    Target Name EDN1
    Gene ID 1906, 13614, 699982, 24323, 494214, 403424, 281137, 100034060
    Gene Symbol and Synonyms ARCND3,EDN1,ET-1,ET1,HDLCQ7,PPET1,preproET,QME
    Uniprot Accession P05305
    Uniprot Entry Name EDN1_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Therapeutics Target
    Disease Not Available
    Gene Ensembl ENSG00000078401
    Target Classification Not Available

    This gene encodes a preproprotein that is proteolytically processed to generate a secreted peptide that belongs to the endothelin/sarafotoxin family. This peptide is a potent vasoconstrictor and its cognate receptors are therapeutic targets in the treatment of pulmonary arterial hypertension. Aberrant expression of this gene may promote tumorigenesis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2015]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.