Human EDN1/ARCND3/ ET1 ORF/cDNA clone-Lentivirus plasmid (NM_001955)
Pre-made Human EDN1/ARCND3/ ET1 Lentiviral expression plasmid for EDN1 lentivirus packaging, EDN1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go
to EDN1/ARCND3 products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Plasmid Grade | Plasmid quantity |
---|---|---|---|
pGMLP001214 | Human EDN1 Lentivirus plasmid | Research Grade | 10mg, 50mg, 100mg, 500mg, >1g |
GMP-like Grade | 10mg, 50mg, 100mg, 500mg, >1g | ||
High Quality (HQ) Grade | |||
Seed | 5ug |
Product Description
Catalog ID | pGMLP001214 |
Gene Name | EDN1 |
Accession Number | NM_001955 |
Gene ID | 1906 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 639 bp |
Gene Alias | ARCND3, ET1, HDLCQ7, PPET1, QME |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGGATTATTTGCTCATGATTTTCTCTCTGCTGTTTGTGGCTTGCCAAGGAGCTCCAGAAACAGCAGTCTTAGGCGCTGAGCTCAGCGCGGTGGGTGAGAACGGCGGGGAGAAACCCACTCCCAGTCCACCCTGGCGGCTCCGCCGGTCCAAGCGCTGCTCCTGCTCGTCCCTGATGGATAAAGAGTGTGTCTACTTCTGCCACCTGGACATCATTTGGGTCAACACTCCCGAGCACGTTGTTCCGTATGGACTTGGAAGCCCTAGGTCCAAGAGAGCCTTGGAGAATTTACTTCCCACAAAGGCAACAGACCGTGAAAATAGATGCCAATGTGCTAGCCAAAAAGACAAGAAGTGCTGGAATTTTTGCCAAGCAGGAAAAGAACTCAGGGCTGAAGACATTATGGAGAAAGACTGGAATAATCATAAGAAAGGAAAAGACTGTTCCAAGCTTGGGAAAAAGTGTATTTATCAGCAGTTAGTGAGAGGAAGAAAAATCAGAAGAAGTTCAGAGGAACACCTAAGACAAACCAGGTCGGAGACCATGAGAAACAGCGTCAAATCATCTTTTCATGATCCCAAGCTGAAAGGCAAGCCCTCCAGAGAGCGTTATGTGACCCACAACCGAGCACATTGGTGA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T25076-Ab | Anti-EDN1/ ARCND3/ ET1 functional antibody |
Target Antigen | GM-Tg-g-T25076-Ag | EDN1 protein |
ORF Viral Vector | pGMLV000129 | Rat Edn1 Lentivirus plasmid |
ORF Viral Vector | pGMLP001214 | Human EDN1 Lentivirus plasmid |
ORF Viral Vector | vGMLV000129 | Rat Edn1 Lentivirus particle |
ORF Viral Vector | vGMLP001214 | Human EDN1 Lentivirus particle |
Target information
Target ID | GM-T25076 |
Target Name | EDN1 |
Gene ID | 1906, 13614, 699982, 24323, 494214, 403424, 281137, 100034060 |
Gene Symbol and Synonyms | ARCND3,EDN1,ET-1,ET1,HDLCQ7,PPET1,preproET,QME |
Uniprot Accession | P05305 |
Uniprot Entry Name | EDN1_HUMAN |
Protein Sub-location | Secreted Protein/Potential Cytokines |
Category | Therapeutics Target |
Disease | Not Available |
Gene Ensembl | ENSG00000078401 |
Target Classification | Not Available |
This gene encodes a preproprotein that is proteolytically processed to generate a secreted peptide that belongs to the endothelin/sarafotoxin family. This peptide is a potent vasoconstrictor and its cognate receptors are therapeutic targets in the treatment of pulmonary arterial hypertension. Aberrant expression of this gene may promote tumorigenesis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2015]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.