Human AGA/AGU/ ASRG ORF/cDNA clone-Lentivirus plasmid (NM_000027)
Pre-made Human AGA/AGU/ ASRG Lentiviral expression plasmid for AGA lentivirus packaging, AGA lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go
to AGA/AGU products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Plasmid Grade | Plasmid quantity |
---|---|---|---|
pGMLP001236 | Human AGA Lentivirus plasmid | Research Grade | 10mg, 50mg, 100mg, 500mg, >1g |
GMP-like Grade | 10mg, 50mg, 100mg, 500mg, >1g | ||
High Quality (HQ) Grade | |||
Seed | 5ug |
Product Description
Catalog ID | pGMLP001236 |
Gene Name | AGA |
Accession Number | NM_000027 |
Gene ID | 175 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 1041 bp |
Gene Alias | AGU, ASRG, GA |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGGCGCGGAAGTCGAACTTGCCTGTGCTTCTCGTGCCGTTTCTGCTCTGCCAGGCCCTAGTGCGCTGCTCCAGCCCTCTGCCCCTGGTCGTCAACACTTGGCCCTTTAAGAATGCAACCGAAGCAGCGTGGAGGGCATTAGCATCTGGAGGCTCTGCCCTGGATGCAGTGGAGAGCGGCTGTGCCATGTGTGAGAGAGAGCAGTGTGACGGCTCTGTAGGCTTTGGAGGAAGTCCTGATGAACTTGGAGAAACCACACTAGATGCCATGATCATGGATGGCACTACTATGGATGTAGGAGCAGTAGGAGATCTCAGACGAATTAAAAATGCTATTGGTGTGGCACGGAAAGTACTGGAACATACAACACACACACTTTTAGTAGGAGAGTCAGCCACCACATTTGCTCAAAGTATGGGGTTTATCAATGAAGACTTATCTACCACTGCTTCTCAAGCTCTTCATTCAGATTGGCTTGCTCGGAATTGCCAGCCAAATTATTGGAGGAATGTTATACCAGATCCCTCAAAATACTGCGGACCCTACAAACCACCTGGTATCTTAAAGCAGGATATTCCTATCCATAAAGAAACAGAAGATGATCGTGGTCATGACACTATTGGCATGGTTGTAATCCATAAGACAGGACATATTGCTGCTGGTACATCTACAAATGGTATAAAATTCAAAATACATGGCCGTGTAGGAGACTCACCAATACCTGGAGCTGGAGCCTATGCTGACGATACTGCAGGGGCAGCCGCAGCCACTGGGAATGGTGATATATTGATGCGCTTCCTGCCAAGCTACCAAGCTGTAGAATACATGAGAAGAGGAGAAGATCCAACCATAGCTTGCCAAAAAGTGATTTCAAGAATCCAGAAGCATTTTCCAGAATTCTTTGGGGCTGTTATATGTGCCAATGTGACTGGAAGTTACGGTGCTGCTTGCAATAAACTTTCAACATTTACTCAGTTTAGTTTCATGGTTTATAATTCCGAAAAAAATCAGCCAACTGAGGAAAAAGTGGACTGCATCTAA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-SE1405-Ab | Anti-ASPG/ AGA/ AGU functional antibody |
Target Antigen | GM-Tg-g-SE1405-Ag | AGA protein |
ORF Viral Vector | pGMLP001236 | Human AGA Lentivirus plasmid |
ORF Viral Vector | vGMLP001236 | Human AGA Lentivirus particle |
Target information
Target ID | GM-SE1405 |
Target Name | AGA |
Gene ID | 175, 11593, 699740, 290923, 101086138, 475638, 511345, 100060636 |
Gene Symbol and Synonyms | AGA,AGU,ASRG,GA |
Uniprot Accession | P20933 |
Uniprot Entry Name | ASPG_HUMAN |
Protein Sub-location | Secreted Protein/Potential Cytokines |
Category | Not Available |
Disease | Not Available |
Gene Ensembl | ENSG00000038002 |
Target Classification | Not Available |
This gene encodes a member of the N-terminal nucleophile (Ntn) hydrolase family of proteins. The encoded preproprotein is proteolytically processed to generate alpha and beta chains that comprise the mature enzyme. This enzyme is involved in the catabolism of N-linked oligosaccharides of glycoproteins. It cleaves asparagine from N-acetylglucosamines as one of the final steps in the lysosomal breakdown of glycoproteins. Mutations in this gene are associated with the lysosomal storage disease aspartylglycosaminuria that results in progressive neurodegeneration. Alternative splicing results in multiple transcript variants, at least one of which encodes an isoform that is subject to proteolytic processing. [provided by RefSeq, Nov 2015]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.