Human AGA/AGU/ ASRG ORF/cDNA clone-Lentivirus particle (NM_000027)

Pre-made Human AGA/AGU/ ASRG Lentiviral expression plasmid for AGA lentivirus packaging, AGA lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collectionGo to AGA/AGU products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP001236 Human AGA Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP001236
Gene Name AGA
Accession Number NM_000027
Gene ID 175
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 1041 bp
Gene Alias AGU, ASRG, GA
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGGCGCGGAAGTCGAACTTGCCTGTGCTTCTCGTGCCGTTTCTGCTCTGCCAGGCCCTAGTGCGCTGCTCCAGCCCTCTGCCCCTGGTCGTCAACACTTGGCCCTTTAAGAATGCAACCGAAGCAGCGTGGAGGGCATTAGCATCTGGAGGCTCTGCCCTGGATGCAGTGGAGAGCGGCTGTGCCATGTGTGAGAGAGAGCAGTGTGACGGCTCTGTAGGCTTTGGAGGAAGTCCTGATGAACTTGGAGAAACCACACTAGATGCCATGATCATGGATGGCACTACTATGGATGTAGGAGCAGTAGGAGATCTCAGACGAATTAAAAATGCTATTGGTGTGGCACGGAAAGTACTGGAACATACAACACACACACTTTTAGTAGGAGAGTCAGCCACCACATTTGCTCAAAGTATGGGGTTTATCAATGAAGACTTATCTACCACTGCTTCTCAAGCTCTTCATTCAGATTGGCTTGCTCGGAATTGCCAGCCAAATTATTGGAGGAATGTTATACCAGATCCCTCAAAATACTGCGGACCCTACAAACCACCTGGTATCTTAAAGCAGGATATTCCTATCCATAAAGAAACAGAAGATGATCGTGGTCATGACACTATTGGCATGGTTGTAATCCATAAGACAGGACATATTGCTGCTGGTACATCTACAAATGGTATAAAATTCAAAATACATGGCCGTGTAGGAGACTCACCAATACCTGGAGCTGGAGCCTATGCTGACGATACTGCAGGGGCAGCCGCAGCCACTGGGAATGGTGATATATTGATGCGCTTCCTGCCAAGCTACCAAGCTGTAGAATACATGAGAAGAGGAGAAGATCCAACCATAGCTTGCCAAAAAGTGATTTCAAGAATCCAGAAGCATTTTCCAGAATTCTTTGGGGCTGTTATATGTGCCAATGTGACTGGAAGTTACGGTGCTGCTTGCAATAAACTTTCAACATTTACTCAGTTTAGTTTCATGGTTTATAATTCCGAAAAAAATCAGCCAACTGAGGAAAAAGTGGACTGCATCTAA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE1405-Ab Anti-ASPG/ AGA/ AGU functional antibody
    Target Antigen GM-Tg-g-SE1405-Ag AGA protein
    ORF Viral Vector pGMLP001236 Human AGA Lentivirus plasmid
    ORF Viral Vector vGMLP001236 Human AGA Lentivirus particle


    Target information

    Target ID GM-SE1405
    Target Name AGA
    Gene ID 175, 11593, 699740, 290923, 101086138, 475638, 511345, 100060636
    Gene Symbol and Synonyms AGA,AGU,ASRG,GA
    Uniprot Accession P20933
    Uniprot Entry Name ASPG_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000038002
    Target Classification Not Available

    This gene encodes a member of the N-terminal nucleophile (Ntn) hydrolase family of proteins. The encoded preproprotein is proteolytically processed to generate alpha and beta chains that comprise the mature enzyme. This enzyme is involved in the catabolism of N-linked oligosaccharides of glycoproteins. It cleaves asparagine from N-acetylglucosamines as one of the final steps in the lysosomal breakdown of glycoproteins. Mutations in this gene are associated with the lysosomal storage disease aspartylglycosaminuria that results in progressive neurodegeneration. Alternative splicing results in multiple transcript variants, at least one of which encodes an isoform that is subject to proteolytic processing. [provided by RefSeq, Nov 2015]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.