Human ZBTB33/ZNF-kaiso/ ZNF348 ORF/cDNA clone-Lentivirus plasmid (NM_001184742)
Pre-made Human ZBTB33/ZNF-kaiso/ ZNF348 Lentiviral expression plasmid for ZBTB33 lentivirus packaging, ZBTB33 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go
to ZBTB33/ZNF-kaiso products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Plasmid Grade | Plasmid quantity |
---|---|---|---|
pGMLP001312 | Human ZBTB33 Lentivirus plasmid | Research Grade | 10mg, 50mg, 100mg, 500mg, >1g |
GMP-like Grade | 10mg, 50mg, 100mg, 500mg, >1g | ||
High Quality (HQ) Grade | |||
Seed | 5ug |
Product Description
Catalog ID | pGMLP001312 |
Gene Name | ZBTB33 |
Accession Number | NM_001184742 |
Gene ID | 10009 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 2019 bp |
Gene Alias | ZNF-kaiso, ZNF348 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGGAGAGTAGAAAACTGATTTCTGCTACAGACATTCAGTACTCTGGCAGTCTGCTGAACTCCTTGAATGAGCAACGTGGCCATGGACTCTTCTGTGATGTTACCGTTATTGTGGAAGACCGAAAATTCCGGGCTCACAAGAATATTCTTTCAGCTTCTAGTACCTACTTCCATCAGCTCTTCTCTGTTGCTGGGCAAGTTGTTGAACTGAGCTTTATAAGAGCAGAGATCTTTGCAGAAATTCTCAATTATATCTATAGTTCTAAAATTGTTCGTGTTAGATCAGATTTGCTTGATGAGTTAATTAAATCAGGGCAGTTATTAGGAGTGAAATTTATAGCAGAGCTTGGTGTCCCATTGTCACAGGTTAAAAGCATCTCAGGTACAGCGCAGGATGGTAATACTGAGCCTTTACCTCCTGATTCTGGTGACAAGAACCTTGTAATACAGAAATCAAAAGATGAAGCCCAAGATAATGGGGCTACTATAATGCCTATTATAACAGAGTCTTTTTCATTATCTGCCGAAGATTATGAAATGAAAAAGATCATTGTTACCGATTCTGATGATGATGATGATGATGTCATTTTTTGCTCCGAGATTCTGCCCACAAAGGAGACTTTGCCGAGTAATAACACAGTGGCACAGGTCCAATCTAACCCAGGCCCTGTTGCTATTTCAGATGTTGCACCTAGTGCTAGCAATAACTCGCCCCCTTTAACAAATATCACACCTACTCAGAAACTTCCTACTCCTGTGAATCAGGCAACTTTGAGCCAAACACAAGGAAGTGAAAAATTGTTGGTATCTTCAGCTCCAACACATCTGACTCCCAATATTATTTTGTTAAATCAGACACCACTTTCTACACCACCAAATGTCAGTTCTTCACTTCCAAATCATATGCCCTCTTCAATCAATTTACTTGTGCAGAATCAGCAGACACCAAACAGTGCTATTTTAACAGGAAACAAGGCCAATGAAGAGGAGGAGGAGGAAATAATAGATGATGATGATGACACTATTAGCTCCAGTCCTGACTCGGCCGTCAGTAATACATCTTTGGTCCCACAGGCTGATACCTCCCAAAATACCAGTTTTGATGGATCATTAATACAGAAGATGCAGATTCCTACACTTCTTCAAGAACCACTTTCCAATTCCTTAAAAATTTCAGATATAATTACTAGAAATACTAATGATCCAGGCGTAGGATCAAAACATCTAATGGAGGGTCAGAAGATCATTACTTTAGATACAGCTACTGAAATTGAAGGCTTATCGACTGGTTGCAAGGTTTATGCAAATATCGGTGAAGATACTTATGATATAGTGATCCCTGTCAAAGATGACCCTGATGAAGGGGAGGCCAGACTTGAGAATGAAATACCAAAAACGTCTGGCAGCGAGATGGCAAACAAACGTATGAAAGTAAAACATGATGATCACTATGAGTTAATAGTAGATGGAAGGGTCTATTATATCTGTATTGTATGCAAAAGGTCATATGTCTGTCTGACAAGCTTGCGGAGACATTTTAACATTCATTCTTGGGAGAAGAAGTATCCGTGCCGTTACTGTGAGAAGGTATTTCCTCTTGCAGAATATCGCACAAAGCATGAAATTCATCACACAGGGGAGCGAAGGTATCAGTGTTTGGCCTGTGGCAAATCTTTCATCAACTATCAGTTTATGTCTTCACATATAAAGTCAGTTCATAGTCAAGATCCTTCTGGGGACTCAAAGCTTTATCGTTTACATCCATGCAGGTCTTTACAAATCAGACAATATGCATATCTTTCCGATAGATCAAGCACTATTCCTGCAATGAAGGATGATGGTATTGGGTATAAGGTTGACACTGGAAAAGAACCTCCAGTAGGGACCACTACATCTACTCAGAACAAGCCAATGACCTGGGAAGATATTTTTATTCAGCAGGAAAATGATTCAATTTTTAAACAAAATGTAACAGATGGCAGTACTGAGTTTGAATTTATAATACCAGAGTCTTACTAA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-MP2391-Ab | Anti-KAISO/ ZBTB33/ ZNF-kaiso monoclonal antibody |
Target Antigen | GM-Tg-g-MP2391-Ag | ZBTB33 VLP (virus-like particle) |
ORF Viral Vector | pGMAD000086 | Human ZBTB33 Adenovirus plasmid |
ORF Viral Vector | pGMLP001312 | Human ZBTB33 Lentivirus plasmid |
ORF Viral Vector | vGMAD000086 | Human ZBTB33 Adenovirus particle |
ORF Viral Vector | vGMLP001312 | Human ZBTB33 Lentivirus particle |
Target information
Target ID | GM-MP2391 |
Target Name | ZBTB33 |
Gene ID | 10009, 56805, 695801, 501506, 101086378, 100685062, 784871, 100062002 |
Gene Symbol and Synonyms | E130014G12Rik,Kaiso,RGD1566309,ZBTB33,ZNF-kaiso,ZNF348 |
Uniprot Accession | Q86T24 |
Uniprot Entry Name | KAISO_HUMAN |
Protein Sub-location | Transmembrane Protein |
Category | Not Available |
Disease | Not Available |
Gene Ensembl | ENSG00000177485 |
Target Classification | Not Available |
This gene encodes a transcriptional regulator with bimodal DNA-binding specificity, which binds to methylated CGCG and also to the non-methylated consensus KAISO-binding site TCCTGCNA. The protein contains an N-terminal POZ/BTB domain and 3 C-terminal zinc finger motifs. It recruits the N-CoR repressor complex to promote histone deacetylation and the formation of repressive chromatin structures in target gene promoters. It may contribute to the repression of target genes of the Wnt signaling pathway, and may also activate transcription of a subset of target genes by the recruitment of catenin delta-2 (CTNND2). Its interaction with catenin delta-1 (CTNND1) inhibits binding to both methylated and non-methylated DNA. It also interacts directly with the nuclear import receptor Importin-α2 (also known as karyopherin alpha2 or RAG cohort 1), which may mediate nuclear import of this protein. Alternatively spliced transcript variants encoding the same protein have been identified.[provided by RefSeq, May 2010]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.