Human MMP13/CLG3/ MANDP1 ORF/cDNA clone-Lentivirus plasmid (NM_002427)

Pre-made Human MMP13/CLG3/ MANDP1 Lentiviral expression plasmid for MMP13 lentivirus packaging, MMP13 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

Target products collectionGo to MMP-13/MMP13/CLG3 products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMLP001400 Human MMP13 Lentivirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMLP001400
Gene Name MMP13
Accession Number NM_002427
Gene ID 4322
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 1416 bp
Gene Alias CLG3, MANDP1, MDST, MMP-13
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGCATCCAGGGGTCCTGGCTGCCTTCCTCTTCTTGAGCTGGACTCATTGTCGGGCCCTGCCCCTTCCCAGTGGTGGTGATGAAGATGATTTGTCTGAGGAAGACCTCCAGTTTGCAGAGCGCTACCTGAGATCATACTACCATCCTACAAATCTCGCGGGAATCCTGAAGGAGAATGCAGCAAGCTCCATGACTGAGAGGCTCCGAGAAATGCAGTCTTTCTTCGGCTTAGAGGTGACTGGCAAACTTGACGATAACACCTTAGATGTCATGAAAAAGCCAAGATGCGGGGTTCCTGATGTGGGTGAATACAATGTTTTCCCTCGAACTCTTAAATGGTCCAAAATGAATTTAACCTACAGAATTGTGAATTACACCCCTGATATGACTCATTCTGAAGTCGAAAAGGCATTCAAAAAAGCCTTCAAAGTTTGGTCCGATGTAACTCCTCTGAATTTTACCAGACTTCACGATGGCATTGCTGACATCATGATCTCTTTTGGAATTAAGGAGCATGGCGACTTCTACCCATTTGATGGGCCCTCTGGCCTGCTGGCTCATGCTTTTCCTCCTGGGCCAAATTATGGAGGAGATGCCCATTTTGATGATGATGAAACCTGGACAAGTAGTTCCAAAGGCTACAACTTGTTTCTTGTTGCTGCGCATGAGTTCGGCCACTCCTTAGGTCTTGACCACTCCAAGGACCCTGGAGCACTCATGTTTCCTATCTACACCTACACCGGCAAAAGCCACTTTATGCTTCCTGATGACGATGTACAAGGGATCCAGTCTCTCTATGGTCCAGGAGATGAAGACCCCAACCCTAAACATCCAAAAACGCCAGACAAATGTGACCCTTCCTTATCCCTTGATGCCATTACCAGTCTCCGAGGAGAAACAATGATCTTTAAAGACAGATTCTTCTGGCGCCTGCATCCTCAGCAGGTTGATGCGGAGCTGTTTTTAACGAAATCATTTTGGCCAGAACTTCCCAACCGTATTGATGCTGCATATGAGCACCCTTCTCATGACCTCATCTTCATCTTCAGAGGTAGAAAATTTTGGGCTCTTAATGGTTATGACATTCTGGAAGGTTATCCCAAAAAAATATCTGAACTGGGTCTTCCAAAAGAAGTTAAGAAGATAAGTGCAGCTGTTCACTTTGAGGATACAGGCAAGACTCTCCTGTTCTCAGGAAACCAGGTCTGGAGATATGATGATACTAACCATATTATGGATAAAGACTATCCGAGACTAATAGAAGAAGACTTCCCAGGAATTGGTGATAAAGTAGATGCTGTCTATGAGAAAAATGGTTATATCTATTTTTTCAACGGACCCATACAGTTTGAATACAGCATCTGGAGTAACCGTATTGTTCGCGTCATGCCAGCAAATTCCATTTTGTGGTGTTAA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T34296-Ab Anti-MMP13/ MMP-13/ CLG3 functional antibody
    Target Antigen GM-Tg-g-T34296-Ag MMP-13/MMP13 protein
    ORF Viral Vector pGMLP001400 Human MMP13 Lentivirus plasmid
    ORF Viral Vector pGMAP000290 Human MMP13 Adenovirus plasmid
    ORF Viral Vector vGMLP001400 Human MMP13 Lentivirus particle
    ORF Viral Vector vGMAP000290 Human MMP13 Adenovirus particle


    Target information

    Target ID GM-T34296
    Target Name MMP-13
    Gene ID 4322, 17386, 703980, 171052, 493679, 403763, 281914, 100009711
    Gene Symbol and Synonyms Clg,CLG3,MANDP1,MDST,MMP-13,Mmp1,MMP13
    Uniprot Accession P45452
    Uniprot Entry Name MMP13_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Therapeutics Target
    Disease Cancer
    Gene Ensembl ENSG00000137745
    Target Classification Tumor-associated antigen (TAA)

    This gene encodes a member of the peptidase M10 family of matrix metalloproteinases (MMPs). Proteins in this family are involved in the breakdown of extracellular matrix in normal physiological processes, such as embryonic development, reproduction, and tissue remodeling, as well as in disease processes, such as arthritis and metastasis. The encoded preproprotein is proteolytically processed to generate the mature protease. This protease cleaves type II collagen more efficiently than types I and III. It may be involved in articular cartilage turnover and cartilage pathophysiology associated with osteoarthritis. Mutations in this gene are associated with metaphyseal anadysplasia. This gene is part of a cluster of MMP genes on chromosome 11. [provided by RefSeq, Jan 2016]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.