Human MMP13/CLG3 ORF/cDNA clone-Adenovirus plasmid (BC067522)
Pre-made Human MMP13/CLG3 adenoviral expression plasmid for MMP13 adenovirus packaging, MMP13 adenovirus.
Our GM-Adenovirus vector is optimized with the GMVC-modified Adeasy adenovirus packaging system. Find more about the GMVC-modified adenovirus packaging system.
Go
to MMP-13/MMP13/CLG3 products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Plasmid Grade | Plasmid quantity |
---|---|---|---|
pGMAP000290 | Human MMP13 Adenovirus plasmid | Research Grade | 10mg, 50mg, 100mg, 500mg, >1g |
GMP-like Grade | 10mg, 50mg, 100mg, 500mg, >1g | ||
High Quality (HQ) Grade | |||
Seed | 5ug |
Product Description
Catalog ID | pGMAP000290 |
Gene Name | MMP13 |
Accession Number | BC067522 |
Gene ID | 4322 |
Species | Human |
Product Type | Adenovirus plasmid (overexpression) |
Insert Length | 1416 bp |
Gene Alias | CLG3 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGCATCCAGGGGTCCTGGCTGCCTTCCTCTTCTTGAGCTGGACTCATTGTCGGGCCCTGCCCCTTCCCAGTGGTGGTGATGAAGATGATTTGTCTGAGGAAGACCTCCAGTTTGCAGAGCGCTACCTGAGATCATACTACCATCCTACAAATCTCGCGGGAATCCTGAAGGAGAATGCAGCAAGCTCCATGACTGAGAGGCTCCGAGAAATGCAGTCTTTCTTCGGCTTAGAGGTGACTGGCAAACTTGACGATAACACCTTAGATGTCATGAAAAAGCCAAGATGCGGGGTTCCTGATGTGGGTGAATACAATGTTTTCCCTCGAACTCTTAAATGGTCCAAAATGAATTTAACCTACAGAATTGTGAATTACACCCCTGATATGACTCATTCTGAAGTCGAAAAGGCATTCAAAAAAGCCTTCAAAGTTTGGTCCGATGTAACTCCTCTGAATTTTACCAGACTTCACGATGGCATTGCTGACATCATGATCTCTTTTGGAATTAAGGAGCATGGCGACTTCTACCCATTTGATGGGCCCTCTGGCCTGCTGGCTCATGCTTTTCCTCCTGGGCCAAATTATGGAGGAGATGCCCATTTTGATGATGATGAAACCTGGACAAGTAGTTCCAAAGGCTACAACTTGTTTCTTGTTGCTGCGCATGAGTTCGGCCACTCCTTAGGTCTTGACCACTCCAAGGACCCTGGAGCACTCATGTTTCCTATCTACACCTACACCGGCAAAAGCCACTTTATGCTTCCTGATGACGATGTACAAGGGATCCAGTCTCTCTATGGTCCAGGAGATGAAGACCCCAACCCTAAACATCCAAAAACGCCAGACAAATGTGACCCTTCCTTATCCCTTGATGCCATTACCAGTCTCCGAGGAGAAACAATGATCTTTAAAGACAGATTCTTCTGGCGCCTGCATCCTCAGCAGGTTGATGCGGAGCTGTTTTTAACGAAATCATTTTGGCCAGAACTTCCCAACCGTATTGATGCTGCATATGAGCACCCTTCTCATGACCTCATCTTCATCTTCAGAGGTAGAAAATTTTGGGCTCTTAATGGTTATGACATTCTGGAAGGTTATCCCAAAAAAATATCTGAACTGGGTCTTCCAAAAGAAGTTAAGAAGATAAGTGCAGCTGTTCACTTTGAGGATACAGGCAAGACTCTCCTGTTCTCAGGAAACCAGGTCTGGAGATATGATGATACTAACCATATTATGGATAAAGACTATCCGAGACTAATAGAAGAAGACTTCCCAGGAATTGGTGATAAAGTAGATGCTGTCTATGAGAAAAATGGTTATATCTATTTTTTCAACGGACCCATACAGTTTGAATACAGCATCTGGAGTAACCGTATTGTTCGCGTCATGCCAGCAAATTCCATTTTGTGGTGTTAA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T34296-Ab | Anti-MMP13/ MMP-13/ CLG3 functional antibody |
Target Antigen | GM-Tg-g-T34296-Ag | MMP-13/MMP13 protein |
ORF Viral Vector | pGMLP001400 | Human MMP13 Lentivirus plasmid |
ORF Viral Vector | pGMAP000290 | Human MMP13 Adenovirus plasmid |
ORF Viral Vector | vGMLP001400 | Human MMP13 Lentivirus particle |
ORF Viral Vector | vGMAP000290 | Human MMP13 Adenovirus particle |
Target information
Target ID | GM-T34296 |
Target Name | MMP-13 |
Gene ID | 4322, 17386, 703980, 171052, 493679, 403763, 281914, 100009711 |
Gene Symbol and Synonyms | Clg,CLG3,MANDP1,MDST,MMP-13,Mmp1,MMP13 |
Uniprot Accession | P45452 |
Uniprot Entry Name | MMP13_HUMAN |
Protein Sub-location | Secreted Protein/Potential Cytokines |
Category | Therapeutics Target |
Disease | Cancer |
Gene Ensembl | ENSG00000137745 |
Target Classification | Tumor-associated antigen (TAA) |
This gene encodes a member of the peptidase M10 family of matrix metalloproteinases (MMPs). Proteins in this family are involved in the breakdown of extracellular matrix in normal physiological processes, such as embryonic development, reproduction, and tissue remodeling, as well as in disease processes, such as arthritis and metastasis. The encoded preproprotein is proteolytically processed to generate the mature protease. This protease cleaves type II collagen more efficiently than types I and III. It may be involved in articular cartilage turnover and cartilage pathophysiology associated with osteoarthritis. Mutations in this gene are associated with metaphyseal anadysplasia. This gene is part of a cluster of MMP genes on chromosome 11. [provided by RefSeq, Jan 2016]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.