Human MMP13/CLG3 ORF/cDNA clone-Adenovirus particle (BC067522)

Pre-made Human MMP13/CLG3 Adenovirus for MMP13 overexpression in-vitro and in-vivo. The MMP13 adenoviral vector excels as a vehicle for transient gene transfection in both stable cell lines and primary cells, including DC cells, macrophages, cardiomyocytes, hepatocytes, and neurons. The purified MMP13-encoding adenovirus also stands out as a quintessential tool for in vivo studies and vaccine research initiatives.

At GM Vector Core (GMVC), we provide bespoke adenovirus development and manufacture various grades of adenoviruses utilizing cutting-edge techniques. Dive deeper into our offerings.

Target products collectionGo to MMP-13/MMP13/CLG3 products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Adenovirus Grade Adenovirus quantity
vGMAP000290 Human MMP13 Adenovirus particle Research Grade-In vitro 1E+10PFU (1E+10pfu/ml×1ml)
5E+10PFU (1E+10pfu/ml×5ml)
1E+11PFU (1E+10pfu/ml×10ml)
Research Grade-In vivo 1E+11PFU (1E+11pfu/ml×1ml)
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMAP000290
Gene Name MMP13
Accession Number BC067522
Gene ID 4322
Species Human
Product Type Adenovirus particle (overexpression)
Insert Length 1416 bp
Gene Alias CLG3
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGCATCCAGGGGTCCTGGCTGCCTTCCTCTTCTTGAGCTGGACTCATTGTCGGGCCCTGCCCCTTCCCAGTGGTGGTGATGAAGATGATTTGTCTGAGGAAGACCTCCAGTTTGCAGAGCGCTACCTGAGATCATACTACCATCCTACAAATCTCGCGGGAATCCTGAAGGAGAATGCAGCAAGCTCCATGACTGAGAGGCTCCGAGAAATGCAGTCTTTCTTCGGCTTAGAGGTGACTGGCAAACTTGACGATAACACCTTAGATGTCATGAAAAAGCCAAGATGCGGGGTTCCTGATGTGGGTGAATACAATGTTTTCCCTCGAACTCTTAAATGGTCCAAAATGAATTTAACCTACAGAATTGTGAATTACACCCCTGATATGACTCATTCTGAAGTCGAAAAGGCATTCAAAAAAGCCTTCAAAGTTTGGTCCGATGTAACTCCTCTGAATTTTACCAGACTTCACGATGGCATTGCTGACATCATGATCTCTTTTGGAATTAAGGAGCATGGCGACTTCTACCCATTTGATGGGCCCTCTGGCCTGCTGGCTCATGCTTTTCCTCCTGGGCCAAATTATGGAGGAGATGCCCATTTTGATGATGATGAAACCTGGACAAGTAGTTCCAAAGGCTACAACTTGTTTCTTGTTGCTGCGCATGAGTTCGGCCACTCCTTAGGTCTTGACCACTCCAAGGACCCTGGAGCACTCATGTTTCCTATCTACACCTACACCGGCAAAAGCCACTTTATGCTTCCTGATGACGATGTACAAGGGATCCAGTCTCTCTATGGTCCAGGAGATGAAGACCCCAACCCTAAACATCCAAAAACGCCAGACAAATGTGACCCTTCCTTATCCCTTGATGCCATTACCAGTCTCCGAGGAGAAACAATGATCTTTAAAGACAGATTCTTCTGGCGCCTGCATCCTCAGCAGGTTGATGCGGAGCTGTTTTTAACGAAATCATTTTGGCCAGAACTTCCCAACCGTATTGATGCTGCATATGAGCACCCTTCTCATGACCTCATCTTCATCTTCAGAGGTAGAAAATTTTGGGCTCTTAATGGTTATGACATTCTGGAAGGTTATCCCAAAAAAATATCTGAACTGGGTCTTCCAAAAGAAGTTAAGAAGATAAGTGCAGCTGTTCACTTTGAGGATACAGGCAAGACTCTCCTGTTCTCAGGAAACCAGGTCTGGAGATATGATGATACTAACCATATTATGGATAAAGACTATCCGAGACTAATAGAAGAAGACTTCCCAGGAATTGGTGATAAAGTAGATGCTGTCTATGAGAAAAATGGTTATATCTATTTTTTCAACGGACCCATACAGTTTGAATACAGCATCTGGAGTAACCGTATTGTTCGCGTCATGCCAGCAAATTCCATTTTGTGGTGTTAA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T34296-Ab Anti-MMP13/ MMP-13/ CLG3 functional antibody
    Target Antigen GM-Tg-g-T34296-Ag MMP-13/MMP13 protein
    ORF Viral Vector pGMLP001400 Human MMP13 Lentivirus plasmid
    ORF Viral Vector pGMAP000290 Human MMP13 Adenovirus plasmid
    ORF Viral Vector vGMLP001400 Human MMP13 Lentivirus particle
    ORF Viral Vector vGMAP000290 Human MMP13 Adenovirus particle


    Target information

    Target ID GM-T34296
    Target Name MMP-13
    Gene ID 4322, 17386, 703980, 171052, 493679, 403763, 281914, 100009711
    Gene Symbol and Synonyms Clg,CLG3,MANDP1,MDST,MMP-13,Mmp1,MMP13
    Uniprot Accession P45452
    Uniprot Entry Name MMP13_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Therapeutics Target
    Disease Cancer
    Gene Ensembl ENSG00000137745
    Target Classification Tumor-associated antigen (TAA)

    This gene encodes a member of the peptidase M10 family of matrix metalloproteinases (MMPs). Proteins in this family are involved in the breakdown of extracellular matrix in normal physiological processes, such as embryonic development, reproduction, and tissue remodeling, as well as in disease processes, such as arthritis and metastasis. The encoded preproprotein is proteolytically processed to generate the mature protease. This protease cleaves type II collagen more efficiently than types I and III. It may be involved in articular cartilage turnover and cartilage pathophysiology associated with osteoarthritis. Mutations in this gene are associated with metaphyseal anadysplasia. This gene is part of a cluster of MMP genes on chromosome 11. [provided by RefSeq, Jan 2016]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.