Human TGFBR1/AAT5/ ACVRLK4 ORF/cDNA clone-Lentivirus plasmid (NM_004612)

Pre-made Human TGFBR1/AAT5/ ACVRLK4 Lentiviral expression plasmid for TGFBR1 lentivirus packaging, TGFBR1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

Target products collectionGo to TGFBR1/AAT5 products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMLP001434 Human TGFBR1 Lentivirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMLP001434
Gene Name TGFBR1
Accession Number NM_004612
Gene ID 7046
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 1512 bp
Gene Alias AAT5, ACVRLK4, ALK-5, ALK5, ESS1, LDS1, LDS1A, LDS2A, MSSE, SKR4, tbetaR-I, TGFR-1
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGGAGGCGGCGGTCGCTGCTCCGCGTCCCCGGCTGCTCCTCCTCGTGCTGGCGGCGGCGGCGGCGGCGGCGGCGGCGCTGCTCCCGGGGGCGACGGCGTTACAGTGTTTCTGCCACCTCTGTACAAAAGACAATTTTACTTGTGTGACAGATGGGCTCTGCTTTGTCTCTGTCACAGAGACCACAGACAAAGTTATACACAACAGCATGTGTATAGCTGAAATTGACTTAATTCCTCGAGATAGGCCGTTTGTATGTGCACCCTCTTCAAAAACTGGGTCTGTGACTACAACATATTGCTGCAATCAGGACCATTGCAATAAAATAGAACTTCCAACTACTGTAAAGTCATCACCTGGCCTTGGTCCTGTGGAACTGGCAGCTGTCATTGCTGGACCAGTGTGCTTCGTCTGCATCTCACTCATGTTGATGGTCTATATCTGCCACAACCGCACTGTCATTCACCATCGAGTGCCAAATGAAGAGGACCCTTCATTAGATCGCCCTTTTATTTCAGAGGGTACTACGTTGAAAGACTTAATTTATGATATGACAACGTCAGGTTCTGGCTCAGGTTTACCATTGCTTGTTCAGAGAACAATTGCGAGAACTATTGTGTTACAAGAAAGCATTGGCAAAGGTCGATTTGGAGAAGTTTGGAGAGGAAAGTGGCGGGGAGAAGAAGTTGCTGTTAAGATATTCTCCTCTAGAGAAGAACGTTCGTGGTTCCGTGAGGCAGAGATTTATCAAACTGTAATGTTACGTCATGAAAACATCCTGGGATTTATAGCAGCAGACAATAAAGACAATGGTACTTGGACTCAGCTCTGGTTGGTGTCAGATTATCATGAGCATGGATCCCTTTTTGATTACTTAAACAGATACACAGTTACTGTGGAAGGAATGATAAAACTTGCTCTGTCCACGGCGAGCGGTCTTGCCCATCTTCACATGGAGATTGTTGGTACCCAAGGAAAGCCAGCCATTGCTCATAGAGATTTGAAATCAAAGAATATCTTGGTAAAGAAGAATGGAACTTGCTGTATTGCAGACTTAGGACTGGCAGTAAGACATGATTCAGCCACAGATACCATTGATATTGCTCCAAACCACAGAGTGGGAACAAAAAGGTACATGGCCCCTGAAGTTCTCGATGATTCCATAAATATGAAACATTTTGAATCCTTCAAACGTGCTGACATCTATGCAATGGGCTTAGTATTCTGGGAAATTGCTCGACGATGTTCCATTGGTGGAATTCATGAAGATTACCAACTGCCTTATTATGATCTTGTACCTTCTGACCCATCAGTTGAAGAAATGAGAAAAGTTGTTTGTGAACAGAAGTTAAGGCCAAATATCCCAAACAGATGGCAGAGCTGTGAAGCCTTGAGAGTAATGGCTAAAATTATGAGAGAATGTTGGTATGCCAATGGAGCAGCTAGGCTTACAGCATTGCGGATTAAGAAAACATTATCGCAACTCAGTCAACAGGAAGGCATCAAAATGTAA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T53389-Ab Anti-TGFR1/ TGFBR1/ AAT5 monoclonal antibody
    Target Antigen GM-Tg-g-T53389-Ag TGFBR1 VLP (virus-like particle)
    Cytokine cks-Tg-g-GM-T53389 transforming growth factor, beta receptor 1 (TGFBR1) protein & antibody
    ORF Viral Vector pGMLV001800 Human TGFBR1 Lentivirus plasmid
    ORF Viral Vector pGMPC000232 Human TGFBR1 Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector pGMPC001077 Human TGFBR1 Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector pGMLP001434 Human TGFBR1 Lentivirus plasmid
    ORF Viral Vector pGMLP-SPh-040 Human TGFBR1 Lentivirus plasmid
    ORF Viral Vector pGMAP-SPh-180 Human TGFBR1 Adenovirus plasmid
    ORF Viral Vector vGMLV001800 Human TGFBR1 Lentivirus particle
    ORF Viral Vector vGMLP001434 Human TGFBR1 Lentivirus particle
    ORF Viral Vector vGMLP-SPh-040 Human TGFBR1 Lentivirus particle
    ORF Viral Vector vGMAP-SPh-180 Human TGFBR1 Adenovirus particle


    Target information

    Target ID GM-T53389
    Target Name TGFBR1
    Gene ID 7046, 21812, 714952, 29591, 101094057, 481628, 282382, 100034117
    Gene Symbol and Synonyms AAT5,ACVRLK4,ALK-5,ALK5,ESK2,ESS1,LDS1,LDS1A,LDS2A,MSSE,SKR4,tbetaR-I,TbetaRI,TBR-i,TBRI,TGFBR1,TGFR-1
    Uniprot Accession P36897
    Uniprot Entry Name TGFR1_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target, Immuno-oncology Target, Cytokine Target
    Disease Cancer
    Gene Ensembl ENSG00000106799
    Target Classification Checkpoint-Immuno Oncology, Kinase, Tumor-associated antigen (TAA)

    The protein encoded by this gene forms a heteromeric complex with type II TGF-beta receptors when bound to TGF-beta, transducing the TGF-beta signal from the cell surface to the cytoplasm. The encoded protein is a serine/threonine protein kinase. Mutations in this gene have been associated with Loeys-Dietz aortic aneurysm syndrome (LDAS). Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2008]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.